Busch Lab

ZMP

crfb1

Ensembl ID:
ENSDARG00000068681
ZFIN ID:
ZDB-GENE-030131-8673
Description:
cytokine receptor family member b1 [Source:RefSeq peptide;Acc:NP_001073149]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa285 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

Allele Name:
sa285
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099426 Nonsense 41 546 4 10
ENSDART00000110457 Nonsense 41 546 2 8
ENSDART00000137087 Nonsense 41 425 4 8

The following transcripts of ENSDARG00000068681 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 19719760)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 19094002
GRCz11 9 19101714
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGCTCCTGTCAACTTTACAATATGGTCTCACAACTTCAGACACATTT[T/A]ACACTGGAATTATGGGGTAAATTCTCCTCCACAGAGCGTTTTCAATTTAC
Long Flanking Sequence:
CGAGGTTTTTTGGTGATGGTGTTAGACACTCCTAACACATTTTTCATTAATTTGACTGGAATGAGATCAAATATACATGTAGCTGATTAACACGTATTGATACATTTATTTATCTCTTCTTTTCTATCACACTGTCTTCCTGTCCTCATGACAGTTGTCTTCAAATAGTGATCCTAATTATCTGCTTTGTTTTGTATTTTTATTTTAGTGTGACTCTGCTTTTGTTTGTGAAATATGATTGGTTATCAAAATGAAGACATCATCATCATACACTGGCCGTCTTTTTCTCATTCATCTTTACTTTACAGGTATGATCTTGGCGGGTTAGGTGGATTTGGGGTGTGCAACCAAAATTAAATAACATATTAAAATTTAAAAGAAACATAACAAGTATGTAATATGTTTAAGTGACACTTGTGTTTATGATTTTCTCCTAGTGATCTATGCAATCCCTGCTCCTGTCAACTTTACAATATGGTCTCACAACTTCAGACACATTT[T/A]ACACTGGAATTATGGGGTAAATTCTCCTCCACAGAGCGTTTTCAATTTACAAAGGTATGATTCTAAAGCAGTTTTTTATGTTTCCTCAAATACCAACAGTGTGCACACTGCAAAAAAAAAAAGTGTATTCCTTACTTAGATTTTTTTTGTCTTCTGACTAGTCCAAATATCTAATAATAATATTTGTCTAATTACCCTTACCTGCCTAGTTAACCTAATTAACATAGTTAAGCATTTAAATGTCATTTAAAGCTGTATAGAAGTGTCTTAACATTTAGTAAAATATTGTTTACTGTCATCATGGCAAAGATAAAATAAATCAGTTATTAGAAATGAGTTATTAAAACTATTATCTTCAGAAACGTGTTGAAAAAAAATCTTCTCTCCATTAAACAGAAATTGGGCAAAAAATAAACAGGGGGGGCTAATAATTCAGGGTGGCTAATAATTCTGACTTCAACTGTATATCTGTGATCGGGAGTTTTTCCACTGGTGACTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7179
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099426 Nonsense 342 546 10 10
ENSDART00000110457 Nonsense 342 546 8 8
ENSDART00000137087 Nonsense 221 425 8 8

The following transcripts of ENSDARG00000068681 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 19736819)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 19111061
GRCz11 9 19118773
KASP Assay ID:
554-4448.1 (used for ordering genotyping assays)
KASP Sequence:
AGGAAGACAGTAATGATGAAGACGAAGTCAAATGTGTCTACATGAGTTGT[G/T]AAATTGACGACATTAGTTGTCAAAATAATAGTACAAAGAAGGATATAGTT
Long Flanking Sequence:
TGCTTAAAGCGCCTCCCAGCGGTCAAAAGCTGCAAGCGCGTTTACTGCCTCAAATGCGTGGTGGCAGTAGGAACATATTGAAGTGTTAACATCTGTACATATCAACATATTGTACATATATTGTCAATATATTGTACATATTGGTTGTAGATGTTGTTAATCCATTCAACATTTTTCATTTTTGCAGTTCTCCGCAATAGCATAGACTCGACTCCTGCTTTTAGTTTATCTCTTGCAATAATCTCATCTGGTATTTCTCTCGGTTTGCCTATTGCATTTATGCAAAATTGGATATTCTGTCTAGTGCAATCCCCAAGTATACAGTTAGCTGCCCCACCACTCTTTTTAATAATTGCAAATACTGAAACTGGATCCATTCCATCCTTGTTTTTTTACATAATTGTTTTTTGCTTTGTTTTGTTTTTTCCTCACAGTCAGACACTGAGGATGAGGAAGACAGTAATGATGAAGACGAAGTCAAATGTGTCTACATGAGTTGT[G/T]AAATTGACGACATTAGTTGTCAAAATAATAGTACAAAGAAGGATATAGTTTCAGCTTTGCCATTTAATAAAAGTTCAATTGTCTGCTACACAAAGGAACCAGCCATGGAAAAGATCCAATATGATGATCTGAAGAGTGAAAAGGAATTATTATCAGAGCTTTTCGAAGAGGGACATGGACATCTTGAAGTGACAAATACTCAGTTAAAAACTGAGGGAAATGAGAAGGGTTCAACAAATACCCCAGGGAACATCAACCTATTTTCAGTCACTGTGAGGACTTTTGGAGCAGAAGATGACTTGGATAAGGAAGATGTGTATAAACCTCTGCTACCCAAATTGTTTGTAAAAACAGACAAATGGACAGAAGAGCTCTTACCTGTATCTAACAAGATACAGATATCTATACCCATAGAGACAGGCATGAAAACAGATGATCTGATTCATTTGGACAGCCAAAATGATCTTGTTCACGTTTGCTCTTTGGCTCATAACGTAGAA
Associated Phenotype:
Not determined