Busch Lab

ZMP

zgc:152953

Ensembl ID:
ENSDARG00000068636
ZFIN ID:
ZDB-GENE-061103-607
Description:
hypothetical protein LOC571919 [Source:RefSeq peptide;Acc:NP_001073526]
Human Orthologue:
KIAA0649
Human Description:
KIAA0649 [Source:HGNC Symbol;Acc:29089]
Mouse Orthologue:
Gm347
Mouse Description:
predicted gene 347 Gene [Source:MGI Symbol;Acc:MGI:2685193]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa35144 Nonsense Available for shipment Available now
sa41898 Nonsense Mutation detected in F1 DNA Not yet available
sa16533 Nonsense Available for shipment Available now
sa24894 Nonsense Mutation detected in F1 DNA Not yet available
sa45437 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35144
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099351 Nonsense 69 1004 2 3
Genomic Location (Zv9):
Chromosome 11 (position 38626991)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7547815
GRCz11 21 7109306
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATTGAGAGCCTTCACAGTACCCAGTCTTCGGGCATGAGTGAAAACGAG[C/T]AGGCTGAAAAGGCTGCTCATTCCAGTCACGAGGCTGGCTACAAGGGTCAG
Long Flanking Sequence:
TTTCTTGTGCGCTCTCAAATAAATGCGGCTGAAGGGCGATTTAGTGTGCATGGATATAAGGGGTATGTCTCCAACATGTATTAAATCAGCACTACTAAGATTACAGAAAAGTTTGCTCAAAAACATTTTGATGCATTTATAACCCGCTGCAAAAGAAAAAACATCACAACTGAAGGAATGTTTTTACAATTACATGTTTTAAATGAAGATTTCTGCTTCTTTCTTTCAGGATGTAAACAAGATCACTGGTGGAGCTTCCCCATGCACCTGCATCCCTTCCATTCTGACTATCTAGAATGTTCCTGAAGACAGTTCCTCCGGCTGTGGCTATTCATTCAGAATGGAGGTCCAGTAAGAGCTGCAGCCTGCCTCTCTATTTCAATGACAGTGCCTCCGACAGCGACCTTGCCTCAGTTAGTGGCACCCCGTTCCCACAGAAGATCCAGATGATAATTGAGAGCCTTCACAGTACCCAGTCTTCGGGCATGAGTGAAAACGAG[C/T]AGGCTGAAAAGGCTGCTCATTCCAGTCACGAGGCTGGCTACAAGGGTCAGATGCGACTCATGGACATGTCGGCGAGAACCCGGCGATCAGGGTCAGACGCTAAGCTGCAGAACAACAGGTCTGATACTGGAGATGATTCAGATAGTGATGACTCTGTGGACAGAGGCATTGAGGAGGCCATACAGGAGTATTTAAAGGAGAAGGTGGACCACAAGCGCAAAGGGGATCCAGTGACAAGTTCACCCCCAGCGCCCAAACTTCAGCGAAGGGAACTAGATGCTCCGAAACAACAGACACATTCCAGCAGTGCTAAGGTGCTGACTGCTAGCAATCATATCCAGAGACTCTCAAGCGGGATGGTGGCCTTAAAAAAGAAAGTCAAAAAGAAGCAGCTGAGCAAAGAAAATCCCTTTAAGAAAGCAGACGCGAGTAAAGTTTCGCCTTTAAAAAGTCTTCCTCCACCCAGAGCTAAAAAAGGATCCTCCTCGTCTTCTGAGATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4433
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099351 Nonsense 544 1004 3 3
Genomic Location (Zv9):
Chromosome 11 (position 38625239)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7549567
GRCz11 21 7111058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGATGCAGCAATTAAAGACCTACTCAAGACGAAGAAAAAAGTCAAGAAG[A/T]AGGTAAGGGACTTGAAGGCGAGAAAAAGTGACAAACCTTTTGAGGCGTCA
Long Flanking Sequence:
ACAAAGAGCTTCCAGCAACAGCAGGCGCACCTCCACCAGCTTCAGAAGATCCCTCATCGAGTAAAGAGCCAAAGAAGAAGCTGAAAGAAATCCAACCGAATAAAGGAGTCCGACTCTCCTTGTCAAAAAAGCGCAAGTTCAAAGAGGAACAATGCAAACTTTCCAGAGATCAAGACATGGTTTTGAATGTTAAAGAGGAGCCTCCTGGGACACCTCTGATCCACAGTGACTCCACCAGACTTGAACTTTCTACCACTCCCACTGCGATTTCACATTCAAGTAGTGTGAAAAATAGCAAACTGAAACAGAACTCTCCTCCTCGCAAGGGTGCAGATCATGTAACTAAAGACAACGTTTCCTCTTGTAGTGCATCCAGCCCAAAGGCTGCGATCGGCTCTGAGAGAAACGACAGCAGTGACAAAAGCAGCTCCTTGGACAGTGACGAGGATTTAGATGCAGCAATTAAAGACCTACTCAAGACGAAGAAAAAAGTCAAGAAG[A/T]AGGTAAGGGACTTGAAGGCGAGAAAAAGTGACAAACCTTTTGAGGCGTCATCTTTGGATGCCATAAAAAAGCAGAAGCCTTTAACCGAGCAGAAGTGTATCCCACTCAACAGGCTTGTTAAATCTAGCATCTTGAAAGGTGGGAAAGAATCCCTGAACATTCAGGCTAAAAATGACAAGGTGCCTAAAAGCAAACCAGCTAAAGGCAAATGTGAGGTTCAAAACTTCAAGCCTTCTAAAAGCTTTGCGCAGACTGACAAGGTGACCGGGAATGGAGGGATTTCCTCAGCCCCAGGTGGAGACACACTTTCACCAAGTCTGCATGCAGATGACGACAGTGATGTGGACAGCGATGACAGCATTGAGCGAGAGATCAGGAGATTTCTAGCTGAAAGAGCTAAGGTGTCCGCACCTGTAACCACAAACATTAAAAGTGAGGAGAAGGGCATCAACTCCTCATCTGCAGAGACTGAGGAAAATCCAGATCTTCAAAAGACTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41898
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099351 Nonsense 588 1004 3 3
Genomic Location (Zv9):
Chromosome 11 (position 38625106)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7549700
GRCz11 21 7111191
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCGAGCAGAAGTGTATCCCACTCAACAGGCTTGTTAAATCTAGCATCT[T/A]GAAAGGTGGGAAAGAATCCCTGAACATTCAGGCTAAAAATGACAAGGTGC
Long Flanking Sequence:
CAAGTTCAAAGAGGAACAATGCAAACTTTCCAGAGATCAAGACATGGTTTTGAATGTTAAAGAGGAGCCTCCTGGGACACCTCTGATCCACAGTGACTCCACCAGACTTGAACTTTCTACCACTCCCACTGCGATTTCACATTCAAGTAGTGTGAAAAATAGCAAACTGAAACAGAACTCTCCTCCTCGCAAGGGTGCAGATCATGTAACTAAAGACAACGTTTCCTCTTGTAGTGCATCCAGCCCAAAGGCTGCGATCGGCTCTGAGAGAAACGACAGCAGTGACAAAAGCAGCTCCTTGGACAGTGACGAGGATTTAGATGCAGCAATTAAAGACCTACTCAAGACGAAGAAAAAAGTCAAGAAGAAGGTAAGGGACTTGAAGGCGAGAAAAAGTGACAAACCTTTTGAGGCGTCATCTTTGGATGCCATAAAAAAGCAGAAGCCTTTAACCGAGCAGAAGTGTATCCCACTCAACAGGCTTGTTAAATCTAGCATCT[T/A]GAAAGGTGGGAAAGAATCCCTGAACATTCAGGCTAAAAATGACAAGGTGCCTAAAAGCAAACCAGCTAAAGGCAAATGTGAGGTTCAAAACTTCAAGCCTTCTAAAAGCTTTGCGCAGACTGACAAGGTGACCGGGAATGGAGGGATTTCCTCAGCCCCAGGTGGAGACACACTTTCACCAAGTCTGCATGCAGATGACGACAGTGATGTGGACAGCGATGACAGCATTGAGCGAGAGATCAGGAGATTTCTAGCTGAAAGAGCTAAGGTGTCCGCACCTGTAACCACAAACATTAAAAGTGAGGAGAAGGGCATCAACTCCTCATCTGCAGAGACTGAGGAAAATCCAGATCTTCAAAAGACTCAAACTGAAACTCCAGTATCTGCTGCGACATCAACCTCCGGGAGACTCTGGAAGACTGAACTCACAGGTACGTCCACAAAATCTACAGAAACACCTGCAGAACTCAACAAGGGACCAGTCCTGACACCAGGCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16533
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099351 Nonsense 627 1004 3 3
Genomic Location (Zv9):
Chromosome 11 (position 38624990)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7549816
GRCz11 21 7111307
KASP Assay ID:
2260-4595.1 (used for ordering genotyping assays)
KASP Sequence:
CTAAAGGCAAATGYGAGGTTCAAAACTTCAAGCCTTCTAAAAGCYTTGCG[C/T]AGACTGACAAGGTGACCGGGAATGGAGGRATTTCCTCAGCCCCAGGTGGA
Long Flanking Sequence:
CTACCACTCCCACTGCGATTTCACATTCAAGTAGTGTGAAAAATAGCAAACTGAAACAGAACTCTCCTCCTCGCAAGGGTGCAGATCATGTAACTAAAGACAACGTTTCCTCTTGTAGTGCATCCAGCCCAAAGGCTGCGATCGGCTCTGAGAGAAACGACAGCAGTGACAAAAGCAGCTCCTTGGACAGTGACGAGGATTTAGATGCAGCAATTAAAGACCTACTCAAGACGAAGAAAAAAGTCAAGAAGAAGGTAAGGGACTTGAAGGCGAGAAAAAGTGACAAACCTTTTGAGGCGTCATCTTTGGATGCCATAAAAAAGCAGAAGCCTTTAACCGAGCAGAAGTGTATCCCACTCAACAGGCTTGTTAAATCTAGCATCTTGAAAGGTGGGAAAGAATCCCTGAACATTCAGGCTAAAAATGACAAGGTGCCTAAAAGCAAACCAGCTAAAGGCAAATGTGAGGTTCAAAACTTCAAGCCTTCTAAAAGCTTTGCG[C/T]AGACTGACAAGGTGACCGGGAATGGAGGGATTTCCTCAGCCCCAGGTGGAGACACACTTTCACCAAGTCTGCATGCAGATGACGACAGTGATGTGGACAGCGATGACAGCATTGAGCGAGAGATCAGGAGATTTCTAGCTGAAAGAGCTAAGGTGTCCGCACCTGTAACCACAAACATTAAAAGTGAGGAGAAGGGCATCAACTCCTCATCTGCAGAGACTGAGGAAAATCCAGATCTTCAAAAGACTCAAACTGAAACTCCAGTATCTGCTGCGACATCAACCTCCGGGAGACTCTGGAAGACTGAACTCACAGGTACGTCCACAAAATCTACAGAAACACCTGCAGAACTCAACAAGGGACCAGTCCTGACACCAGGCAGCTCTTGCATAATGGGATTCAGGAGGACTGAAAGTCAAAAACCTGAGAACTCTGCTCCAAGAGATCCAACGAATGGCAGCTGCCAGACAGGCAAGGACACTCCGACAGGTCATGTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24894
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099351 Nonsense 708 1004 3 3
Genomic Location (Zv9):
Chromosome 11 (position 38624747)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7550059
GRCz11 21 7111550
KASP Assay ID:
554-7605.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGCATCAACTCCTCATCTGCAGAGACTGAGGAAAATCCAGATCTTCAA[A/T]AGACTCAAACTGAAACTCCAGTATCTGCTGCGACATCAACCTCCGGGAGA
Long Flanking Sequence:
TCAAGAAGAAGGTAAGGGACTTGAAGGCGAGAAAAAGTGACAAACCTTTTGAGGCGTCATCTTTGGATGCCATAAAAAAGCAGAAGCCTTTAACCGAGCAGAAGTGTATCCCACTCAACAGGCTTGTTAAATCTAGCATCTTGAAAGGTGGGAAAGAATCCCTGAACATTCAGGCTAAAAATGACAAGGTGCCTAAAAGCAAACCAGCTAAAGGCAAATGTGAGGTTCAAAACTTCAAGCCTTCTAAAAGCTTTGCGCAGACTGACAAGGTGACCGGGAATGGAGGGATTTCCTCAGCCCCAGGTGGAGACACACTTTCACCAAGTCTGCATGCAGATGACGACAGTGATGTGGACAGCGATGACAGCATTGAGCGAGAGATCAGGAGATTTCTAGCTGAAAGAGCTAAGGTGTCCGCACCTGTAACCACAAACATTAAAAGTGAGGAGAAGGGCATCAACTCCTCATCTGCAGAGACTGAGGAAAATCCAGATCTTCAA[A/T]AGACTCAAACTGAAACTCCAGTATCTGCTGCGACATCAACCTCCGGGAGACTCTGGAAGACTGAACTCACAGGTACGTCCACAAAATCTACAGAAACACCTGCAGAACTCAACAAGGGACCAGTCCTGACACCAGGCAGCTCTTGCATAATGGGATTCAGGAGGACTGAAAGTCAAAAACCTGAGAACTCTGCTCCAAGAGATCCAACGAATGGCAGCTGCCAGACAGGCAAGGACACTCCGACAGGTCATGTCATCAAACCTAATTCCTTCACACCACCATGTGTGAACTCAGAAACTGCTCGGCCGTTGGGTCACCAGCACCAGAACCTGTTCCTGATGAGGCCTGTTAACAACAGAATGAGTGAATCTTCCTCAAGAAACAGTAATGACATTCCCATCAGCCACCAGAGTAGATCAGCCCCAAGGATACCTTTGAGGGAAGTCATTACTTCCCTTTGTCCCTCGCCTCTCTCGAAAACTCAGATTAATTCCCCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45437
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099351 Nonsense 985 1004 3 3
Genomic Location (Zv9):
Chromosome 11 (position 38623915)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7550891
GRCz11 21 7112382
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGCAAGGAAGATGAGGAAGAGAAATGTATTGATGAGACAGATGTAGAGT[C/A]AGATGAGGAAAGGAAAGATCAGAAGACAAAAGACACGAGCAAGCAGACCA
Long Flanking Sequence:
GTTCCTGATGAGGCCTGTTAACAACAGAATGAGTGAATCTTCCTCAAGAAACAGTAATGACATTCCCATCAGCCACCAGAGTAGATCAGCCCCAAGGATACCTTTGAGGGAAGTCATTACTTCCCTTTGTCCCTCGCCTCTCTCGAAAACTCAGATTAATTCCCCTGCTGTTGACCTTTCAACCTCTGTACCTCCGTTGAGCAGGACAGAGGGCGTTTACATGCATAACCGCCTGAAAAGGGACCGACATTTCTCTGATAGACCACACATATCCTTCAGCACCTCACATCTGTGCCAGCCCTCGCCAGAACTGCAGTCCCACCAGGGCGTTAGTGTAATTCAGGTTCAACGGGACCAGGCTGTGTTATTTCAGGCTACGAATCGCCTGCAGGTCAGCCAAACTGAGGTCACTGCAAGTTTAGGAGAAACACAAAGGGAGGGAGGAAGTGTTAGCAAGGAAGATGAGGAAGAGAAATGTATTGATGAGACAGATGTAGAGT[C/A]AGATGAGGAAAGGAAAGATCAGAAGACAAAAGACACGAGCAAGCAGACCAATAATCAGTGAGTACCTATATTTGTTCTTTCCAAATACACACACATATCAGTGATCGGGATGGGGGGAATCCCAATGCATATCCATGCTGTTGATCCATCTAAGATGCAAAAAACTTTCTGAACAAATTGTCTTTGATTGAGGTGATTTAATGAGTGTGTTGGTCATTAGTTCGGATGGATTTATTGATGACCCACAGGTATTTTGAAAGATCTTTCCAAACATTCAGCCGAAATTTTCCTTCGGCGTTAAACATTAGCTGATTATTTTAGCATTAGCCTGACGGACTGCGGCGCTGGAGTTCATCCTGCATTATCATCATTTCTGTCTTTTTGTACTGTATTGTTTAGGTTCCAAGGGACGTCATGTAGGAGTCTTTAAGTGTACCACATCCTCTCTTTTTTTTTTGTATGTTTGTACATTTATAAATATATTTAAAAGCAGACGCGAT
Associated Phenotype:
Not determined