Busch Lab

ZMP

LOC100000685

Ensembl ID:
ENSDARG00000068603
Human Orthologues:
SLC22A4, SLC22A5
Human Descriptions:
solute carrier family 22 (organic cation/carnitine transporter), member 5 [Source:HGNC Symbol;Acc:10
solute carrier family 22 (organic cation/ergothioneine transporter), member 4 [Source:HGNC Symbol;Ac
Mouse Orthologues:
Slc22a21, Slc22a4, Slc22a5
Mouse Descriptions:
solute carrier family 22 (organic cation transporter), member 21 Gene [Source:MGI Symbol;Acc:MGI:192
solute carrier family 22 (organic cation transporter), member 4 Gene [Source:MGI Symbol;Acc:MGI:1353
solute carrier family 22 (organic cation transporter), member 5 Gene [Source:MGI Symbol;Acc:MGI:1329

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa12067 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4164
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099284 Nonsense 191 549 3 10
Genomic Location (Zv9):
Chromosome 21 (position 44304911)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45643529
GRCz11 21 45664155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGCYGCAGAAGCGCTGCTGATGTTCGCTCAGTCTTTCTCTCCCTCCTG[G/A]CTGATCTTCTGTGTTCTCTACTTCTTCATTGGAGCTTTCCAAATATCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12067
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099284 Nonsense 485 549 9 10
Genomic Location (Zv9):
Chromosome 21 (position 44311062)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45637378
GRCz11 21 45670306
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTGAAGGTGTTGTTGACTGATGRATTCTGCTCTTCAGGCACGTTTAAC[A/T]GACACCTGCCGTATGTGCTGATGGGCAGCCTGACCATCACCGCCTCACTG
Associated Phenotype:
Not determined