Busch Lab

ZMP

zgc:153958

Ensembl ID:
ENSDARG00000068602
ZFIN ID:
ZDB-GENE-061103-415
Description:
DALR anticodon-binding domain-containing protein 3 [Source:UniProtKB/Swiss-Prot;Acc:A0JML8]
Human Orthologue:
DALRD3
Human Description:
DALR anticodon binding domain containing 3 [Source:HGNC Symbol;Acc:25536]
Mouse Orthologue:
Dalrd3
Mouse Description:
DALR anticodon binding domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1915039]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa2446 Nonsense F2 line generated Not yet available
sa41222 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa2446
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099283 Nonsense 139 558 2 13
Genomic Location (Zv9):
Chromosome 8 (position 26944714)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26072632
GRCz11 8 26091771
KASP Assay ID:
554-3087.1 (used for ordering genotyping assays)
KASP Sequence:
CTCAAAGACAGGGCTGTGTCCTCATCAACTGTCCGGCCCTCCACACYAAA[C/T]AAAGCGTACCATCTCCAGATACTCTAGCTTTGGGCCAGCTACGCACCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41222
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099283 Essential Splice Site 437 558 9 13
Genomic Location (Zv9):
Chromosome 8 (position 26948507)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26076425
GRCz11 8 26095564
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTCGGCTCCATACACTCTTCAGCAGCTACGAAAAAGGAGTGGAACAAG[G/A]TAAAACGCATACACTTTAGTCACTTATGATTTATATTCAGTATTTTTGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3697
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099283 Nonsense 557 558 13 13
ENSDART00000099283 Nonsense 557 558 13 13
Genomic Location (Zv9):
Chromosome 8 (position 26950244)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26078162
GRCz11 8 26097301
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGAACTTTACCACAGCGCCCTGGACTCCCTGAACCTTCCTCCAATCCCA[C/T]AACTATAGCATCATGCACTCAAGAAGCCACAAACTCTCTCCCTTAACAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5771
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099283 Nonsense 557 558 13 13
ENSDART00000099283 Nonsense 557 558 13 13
Genomic Location (Zv9):
Chromosome 8 (position 26950244)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26078162
GRCz11 8 26097301
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGAACTTTACCACAGCGCCCTGGACTCCCTGAACCTTCCTCCAATCCCA[C/T]AACTATAGCATCATGCACTCAAGAAGCCACAAACTCTCTCCCTTAACAGC
Associated Phenotype:
Not determined