Busch Lab

ZMP

si:ch211-106k21.6

Ensembl ID:
ENSDARG00000068580
ZFIN ID:
ZDB-GENE-070912-8
Human Orthologue:
GLIS1
Human Description:
GLIS family zinc finger 1 [Source:HGNC Symbol;Acc:29525]
Mouse Orthologue:
Glis1
Mouse Description:
GLIS family zinc finger 1 Gene [Source:MGI Symbol;Acc:MGI:2386723]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa19771 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19771
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099228 Nonsense 87 288 1 3
Genomic Location (Zv9):
Chromosome 2 (position 26711888)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26908084
GRCz11 2 26563718
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCATCTTTGTAGCAAGAAGCTTCTAGACAAGGAAGAACTTTTCCAGTA[T/A]CGCAGCAGTGACTGCAAGGAGCATCTTAACTTTCACCATTTTCAGACAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25818
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099228 Nonsense 256 288 3 3
Genomic Location (Zv9):
Chromosome 2 (position 26697522)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26893718
GRCz11 2 26549352
KASP Assay ID:
2259-2063.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTTGCTTTATTATTTTATTCAACACTCTTTATAGAAACCATATGCCTG[T/A]CAGCTTCCAGGATGCACCAAACGTTACACTGATCCCAGCTCACTGCGCAA
Associated Phenotype:
Not determined