Busch Lab

ZMP

Q1MTB6_DANRE

Ensembl ID:
ENSDARG00000068562
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1MTB6]
Human Orthologue:
RBM33
Human Description:
RNA binding motif protein 33 [Source:HGNC Symbol;Acc:27223]
Mouse Orthologue:
Rbm33
Mouse Description:
RNA binding motif protein 33 Gene [Source:MGI Symbol;Acc:MGI:1919670]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34143 Nonsense Mutation detected in F1 DNA Not yet available
sa21042 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4335
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084070 Essential Splice Site 164 1180 5 19
Genomic Location (Zv9):
Chromosome 7 (position 43680975)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40671275
GRCz11 7 40951348
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGAGGTGYTGGACCTTCAGATCGACGAGCCACTGGATGACGATTTCCAAG[T/C]AAGCAATGCGTTCTCCTTTCTTACTCTATGGCTTACACACACTCTCCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34143
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084070 Nonsense 1001 1180 15 19
Genomic Location (Zv9):
Chromosome 7 (position 43656808)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40647108
GRCz11 7 40927181
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGGCATGGCCTGGGTCAGCCTCAGCCCGGTGGAAAAAGAACAGTGATG[C/T]AAAGAACCAACAGTGTTGAATCACCACAAGTTCCACAGAAAGTGCGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21042
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084070 Nonsense 1037 1180 16 19
Genomic Location (Zv9):
Chromosome 7 (position 43650523)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40640823
GRCz11 7 40920896
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTTCAGCAGGCAGATGCCAGTCCCAGCACTGCTCCCTCACAGCAA[C/T]AGCAACCACCAATTGGTCGGCCTATCCCCCAACAGAGGCTTGGTCCCATC
Associated Phenotype:
Not determined