Busch Lab

ZMP

zgc:153084

Ensembl ID:
ENSDARG00000068521
ZFIN ID:
ZDB-GENE-061013-433
Description:
bifunctional polynucleotide phosphatase/kinase [Source:RefSeq peptide;Acc:NP_001071046]
Human Orthologue:
PNKP
Human Description:
polynucleotide kinase 3'-phosphatase [Source:HGNC Symbol;Acc:9154]
Mouse Orthologue:
Pnkp
Mouse Description:
polynucleotide kinase 3'- phosphatase Gene [Source:MGI Symbol;Acc:MGI:1891698]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa35823 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35823
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099140 Essential Splice Site 495 586 15 18
ENSDART00000132052 Essential Splice Site 497 588 15 18
ENSDART00000142909 None None 169 None 4
Genomic Location (Zv9):
Chromosome 15 (position 14016068)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14245643
GRCz11 15 14181600
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGCGTAGCGGTGGACAACACTAACCCGGATCTAGAATCTAGAAAAAGG[T/G]GCCAGCCATTTCCAGAGCAGATGGATGCTTTTTTTTTTTTTTTTTTTTTT
Long Flanking Sequence:
ATGCAAGAGTCTATGGGTGTTTTCCAATACTGGGCTGCAACTGGAAGGGCATCCGCTGTGTAAAACATATGCTGGAATAGTTGCTGGTTTATTCCACTCTGGTGACCCCAAATAAATAAAGGACTAAGCTGAAGGAAAATAAATGAATGAGTAAACATACAGGTTGCTATTAATGATCAGGGATGTGCAAATATAAGTTAACATAATATACAGGTTGTTATTTGCTATAAACAGTATTTTGGGTGTGAATTGCACAAAAATGTTTGATTGTTGTGTAAAAAAATCAACAAATGAGAATTCTTCAGTTATCCACCAATTTGCCACATTGTAAAATAATCATGAAACTATTATAAAAGTGTATTGATTAAGATATCTCTTTTAAATTGCAGGACACAATGGGCTCGTGGCAGCACTGTGTATCAGCTTGTGAACGTGCGCTAAAGGAAGGCAAAAGCGTAGCGGTGGACAACACTAACCCGGATCTAGAATCTAGAAAAAGG[T/G]GCCAGCCATTTCCAGAGCAGATGGATGCTTTTTTTTTTTTTTTTTTTTTTTTTTTAAACTTCTGGCCTTTTTATTGGCACCTAAATTGTGGAACTCTTTACTGATACAGATATTTGCAATGCAGAATCCCTGAGTATTTTTAAATCATCTCTTAAAACTCACCTTTTTATTTATTTATTTTTTATTTTTCTATTTTCTATTATTTTTCTATTTCTATTATATATTATTATTATTATTATTATTATTATTAATTTTTGATTTTTAATAAAAATTTTTATTGCACGTTTTTGCATTTATCCTTGTACTGCAGGGAAAGTATTGAACACGTCATGTTTTTTCTTGGGAATGACATTTCTAAAGGAGCTGTTCACGTGGAATTAAACCAGATTTTGTTAAAAAACTCAAACAATACAAGCATAAAACAAAACAAACAAAATCTGAAAAATTGTTATATGTAATAAAAATGAAATGACACAAGGAGAAAGTACTGAACTACTGGA
Associated Phenotype:
Not determined