Busch Lab

ZMP

si:dkey-94e7.2

Ensembl ID:
ENSDARG00000068474
ZFIN ID:
ZDB-GENE-070912-611
Description:
hypothetical protein LOC100141353 [Source:RefSeq peptide;Acc:NP_001108390]
Human Orthologues:
RDH11, RDH12
Human Descriptions:
retinol dehydrogenase 11 (all-trans/9-cis/11-cis) [Source:HGNC Symbol;Acc:17964]
retinol dehydrogenase 12 (all-trans/9-cis/11-cis) [Source:HGNC Symbol;Acc:19977]
Mouse Orthologues:
Rdh11, Rdh12
Mouse Descriptions:
retinol dehydrogenase 11 Gene [Source:MGI Symbol;Acc:MGI:102581]
retinol dehydrogenase 12 Gene [Source:MGI Symbol;Acc:MGI:1925224]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa9282 Nonsense Mutation detected in F1 DNA Not yet available
sa9352 Nonsense Mutation detected in F1 DNA Not yet available
sa15255 Nonsense Available for shipment Available now
sa32943 Nonsense Mutation detected in F1 DNA Not yet available
sa6848 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9282
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099052 None None 250 2 6
ENSDART00000128982 Nonsense 13 292 1 6
ENSDART00000099052 None None 250 2 6
ENSDART00000128982 Nonsense 13 292 1 6

The following transcripts of ENSDARG00000068474 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 30436332)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30737967
GRCz11 2 30721500
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATGTCCTTGCACNNAGACTTTTTCGGCGGYCAGTGGTCATCTAATGCA[C/T]GACTGGATGATAAAACARTCATTATCACTGGAGCAAATACTGGCATTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9352
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099052 None None 250 2 6
ENSDART00000128982 Nonsense 13 292 1 6
ENSDART00000099052 None None 250 2 6
ENSDART00000128982 Nonsense 13 292 1 6

The following transcripts of ENSDARG00000068474 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 30436332)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30737967
GRCz11 2 30721500
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATGTCCTTGCACNNAGACTTTTTCGGCGGYCAGTGGTCATCTAATGCA[C/T]GACTGGATGATAAAACARTCATTATCACTGGAGCAAATACTGGCATTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15255
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099052 None None 250 2 6
ENSDART00000128982 Nonsense 30 292 1 6

The following transcripts of ENSDARG00000068474 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 30436383)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30738018
GRCz11 2 30721551
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTGGATGATAAAACARTCATTATYACTGGAGCAAATACTGGCATTGGA[A/T]AAGAAACAACAAAAGAYCTGGCAAAACGCGGTAGCACRTTTATCTTAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32943
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099052 Nonsense 14 250 2 6
ENSDART00000128982 Nonsense 58 292 2 6

The following transcripts of ENSDARG00000068474 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 30436600)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30738235
GRCz11 2 30721768
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGGATAATAATGGCTTGCAGAGATGTTGAAAAAGCAGAAAGAGCACAA[A/T]GAGAAATCATGGAAGAATCAGGCAACCAAAACATTGTGATCAGGAAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6848
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099052 Essential Splice Site 217 250 6 6
ENSDART00000128982 Essential Splice Site 259 292 6 6

The following transcripts of ENSDARG00000068474 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 30439483)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30741118
GRCz11 2 30724651
KASP Assay ID:
554-5320.1 (used for ordering genotyping assays)
KASP Sequence:
TGAAATTCATTTACTTTGCATTTTCTTTCTATTCCTTCCCCATTTTTAAA[G/A]TGACTGCAGACCTTCAAGATGCACCAGAGCTGCTAGAGATGATGAAATGG
Associated Phenotype:
Not determined