Busch Lab

ZMP

si:dkey-161j23.4

Ensembl ID:
ENSDARG00000068468
ZFIN ID:
ZDB-GENE-091112-7
Human Orthologue:
DNAH3
Human Description:
dynein, axonemal, heavy chain 3 [Source:HGNC Symbol;Acc:2949]
Mouse Orthologue:
Dnahc3
Mouse Description:
dynein, axonemal, heavy chain 3 Gene [Source:MGI Symbol;Acc:MGI:2683040]

Alleles

There are 15 alleles of this gene:

Allele Name Consequence Status Availability
sa31104 Nonsense Mutation detected in F1 DNA Not yet available
sa44192 Nonsense Mutation detected in F1 DNA Not yet available
sa44193 Nonsense Mutation detected in F1 DNA Not yet available
sa24559 Nonsense Available for shipment Available now
sa37960 Nonsense Mutation detected in F1 DNA Not yet available
sa44194 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8865 Nonsense Mutation detected in F1 DNA Not yet available
sa45015 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4297
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Essential Splice Site 791 3868 16 59
ENSDART00000142998 None None 2661 None 32
Genomic Location (Zv9):
Chromosome 24 (position 41031718)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39570912
GRCz11 24 39458759
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGGGAGTGGGCAGAGCTACACTTTATGTTTGCACCCTATAAGGACACGG[T/A]ACACACACTTAATATGAAACACTAAAAATAGAACACAATCATTATAATTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4282
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 868 3868 18 59
ENSDART00000142998 None None 2661 None 32
Genomic Location (Zv9):
Chromosome 24 (position 41032764)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39571958
GRCz11 24 39459805
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCATGTGGATGTATCTAGAGCCCATTTTCAGCTCGGAGGACATCATCGCA[C/T]AGATGCCAGAAAACGGACGCAAGTTTGCCATCGTAGACAGCTACTGGAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4281
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 1156 3868 24 59
ENSDART00000142998 None None 2661 None 32
Genomic Location (Zv9):
Chromosome 24 (position 41038588)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39577782
GRCz11 24 39465629
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATGGAGAGGTCATGTTGAGGATGATCACCACTGCTATCAGATACGGATA[T/A]GAATATCTTGGCAACTCACCGCGTCTGGTTATAACACCACTAACTGACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31104
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 1357 3868 29 59
ENSDART00000142998 Nonsense 146 2661 4 32
ENSDART00000099041 Nonsense 1357 3868 29 59
ENSDART00000142998 Nonsense 146 2661 4 32
Genomic Location (Zv9):
Chromosome 24 (position 41041111)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39580305
GRCz11 24 39468152
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGGCTCAGAAGATTGTGGCAACGTATCGTCTGTGTTCAGAGCAGCTCT[C/A]GTCTCAACCGCACTACGATTATGGGATGCGTGCGGTGAAATCCGTCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44192
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 1357 3868 29 59
ENSDART00000142998 Nonsense 146 2661 4 32
ENSDART00000099041 Nonsense 1357 3868 29 59
ENSDART00000142998 Nonsense 146 2661 4 32
Genomic Location (Zv9):
Chromosome 24 (position 41041111)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39580305
GRCz11 24 39468152
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGGCTCAGAAGATTGTGGCAACGTATCGTCTGTGTTCAGAGCAGCTCT[C/A]GTCTCAACCGCACTACGATTATGGGATGCGTGCGGTGAAATCCGTCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44193
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 1364 3868 29 59
ENSDART00000142998 Nonsense 153 2661 4 32
Genomic Location (Zv9):
Chromosome 24 (position 41041133)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39580327
GRCz11 24 39468174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGTATCGTCTGTGTTCAGAGCAGCTCTCGTCTCAACCGCACTACGATTA[T/A]GGGATGCGTGCGGTGAAATCCGTCCTGACTGCCGCAGGAAACCTGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24559
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 1542 3868 32 59
ENSDART00000142998 Nonsense 331 2661 7 32
Genomic Location (Zv9):
Chromosome 24 (position 41044440)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39583634
GRCz11 24 39471481
KASP Assay ID:
2261-9083.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGAGTCACGAGTGGTCAGATGGTGTTTTGGCCACTTCATTCAGACAG[C/T]AGGCCCAGTGCACCAATGACGACCGCCAGTGGATCATCTTCGACGGGCCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3266
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 1678 3868 35 59
ENSDART00000142998 Nonsense 467 2661 10 32
Genomic Location (Zv9):
Chromosome 24 (position 41050163)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39589357
GRCz11 24 39477204
KASP Assay ID:
554-3025.1 (used for ordering genotyping assays)
KASP Sequence:
TACCACGAGTGTGGATTCTTRGTTCAGACGTCACCCATTCACCTGGCTTA[C/A]AGTCTGATGCGCCTGTATACCTGTCTGCTGGGTATATRCACACAGTCACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30148
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Essential Splice Site 1905 3868 38 59
ENSDART00000142998 Essential Splice Site 685 2661 13 32
Genomic Location (Zv9):
Chromosome 24 (position 41052376)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39591570
GRCz11 24 39479417
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGGTGTGTTTGGCCCACCGGTTGGCAAGAAGTGCATTATCTATGTTGG[T/G]AAGAACTGAATTTGTTGGTAATATACAGCGGGGAAAATAGGTGTTGAACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1402
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Splice Site, Nonsense 2007 3868 41 59
ENSDART00000142998 Splice Site, Nonsense 787 2661 16 32
Genomic Location (Zv9):
Chromosome 24 (position 41055110)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39594304
GRCz11 24 39482151
KASP Assay ID:
554-1323.1 (used for ordering genotyping assays)
KASP Sequence:
GCTGAAATTCATGATTGAATAATTTCTGGATTAATGCTTCTGTTGTAGGT[T/A]GGGTAAAATCATGGTCCAAGCTACTATGGCAGTGTATAAGGATGCAATCG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa37960
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 2477 3868 47 59
ENSDART00000142998 Nonsense 1257 2661 21 32
Genomic Location (Zv9):
Chromosome 24 (position 41062210)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39601404
GRCz11 24 39489251
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGCAGGAGCTCACAGCTCTACAGCCAGAACTTATCGAGACCGCGAAA[C/T]AGACTGATCAGATGATGGTGAAGATAGAAAAAGAGACAGTGGAGGTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44194
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Essential Splice Site 2517 3868 47 59
ENSDART00000142998 Essential Splice Site 1297 2661 21 32
Genomic Location (Zv9):
Chromosome 24 (position 41062333)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39601527
GRCz11 24 39489374
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGATGAGAAAGTGGCCAATGAAGCAGCAGCTGCTGCTAAAGCGATCAAG[G/T]TAATCAGGTGGAACTGCTTTGACACTTGCATTTGCAAACTTATTTAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8865
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 2712 3868 49 59
ENSDART00000142998 Nonsense 1492 2661 23 32
Genomic Location (Zv9):
Chromosome 24 (position 41065536)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39604730
GRCz11 24 39492577
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTRGAGGACCGTCTGCAGGCACTCAATGACACATTCRAARGGATGATA[C/T]AGAAGAAGAAAGACCTAGAGGCAAACATCGAGCTCTGTTCGCARAAACTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30149
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 3508 3868 54 59
ENSDART00000142998 Nonsense 2301 2661 27 32
Genomic Location (Zv9):
Chromosome 24 (position 41074711)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39613905
GRCz11 24 39501752
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATAAGGACCGGAGACTGCTGATGTCTCTCCTCTCCATCTTCTACAGCTG[G/A]CAGCTCATTCAGCAGGACCAGTATCGTGTGTGTGAGGGAGATCTGTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45015
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 3684 3868 57 59
ENSDART00000142998 Nonsense 2477 2661 30 32
Genomic Location (Zv9):
Chromosome 24 (position 41080336)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39619530
GRCz11 24 39507377
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAGTCTTCTTGTTGGTAAAGTGCCAGCCATGTGGGCTGCAAAGTCCTA[C/A]CCTTCCCTCAAACCCCTCGGCAGCTACGTGTCCGACTTCCTGGCCAGACT
Associated Phenotype:
Not determined