Busch Lab

ZMP

si:ch211-195h23.3

Ensembl ID:
ENSDARG00000068431
ZFIN ID:
ZDB-GENE-070912-174
Description:
si:ch211-195h23.3 [Source:RefSeq peptide;Acc:NP_001123874]
Human Orthologue:
CARD8
Human Description:
caspase recruitment domain family, member 8 [Source:HGNC Symbol;Acc:17057]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31297 Essential Splice Site Available for shipment Available now
sa38353 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa19856 Nonsense Available for shipment Available now
sa19857 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31297
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108591 Essential Splice Site 83 478 5 13
ENSDART00000123673 Essential Splice Site 83 478 5 13
Genomic Location (Zv9):
Chromosome 2 (position 44006429)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44091930
GRCz11 2 43944928
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGTTACAGGCTTCCAAAAAAACTGAAACTGTTTTGGAGCATGTGGATG[G/A]TGAGTAAACATGGTATAATTTTTATTTTAAATGTAATAATAAATGTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38353
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108591 Splice Site, Nonsense 117 478 7 13
ENSDART00000123673 Splice Site, Nonsense 117 478 7 13
Genomic Location (Zv9):
Chromosome 2 (position 44007118)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44092619
GRCz11 2 43945617
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACCTGAACTTATTCAAGAAGATGACAAGTACAAAGACAAGAATACATA[C/A]AGGTATTGAACAGTTGTGTTCTTTGGAATCTGTAAAAAGATAATGTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19856
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108591 Nonsense 365 478 11 13
ENSDART00000123673 Nonsense 365 478 11 13
Genomic Location (Zv9):
Chromosome 2 (position 44013454)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44098955
GRCz11 2 43951953
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACTATTTTAGACAAAGCTGAAGATTGTAAGGAAGTGTGGAGCCGACCA[C/T]GAGTATCACTTAAAGGTAAAAAACATTTGGTTGTTCAAACTTTGTGTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19857
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108591 Nonsense 436 478 13 13
ENSDART00000123673 Nonsense 436 478 13 13
Genomic Location (Zv9):
Chromosome 2 (position 44016483)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44101984
GRCz11 2 43954982
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATACAGCGAACTTCATAATGCCGATACAAATCAGAGGAAAATGAGATG[C/A]CTGTTTATGGCTCTGGACTCTGGAGGAGCTTCTGTGAAAGCAGAGTTTTA
Associated Phenotype:
Not determined