Busch Lab

ZMP

LOC100333117

Ensembl ID:
ENSDARG00000068386
Human Orthologue:
CYLD
Human Description:
cylindromatosis (turban tumor syndrome) [Source:HGNC Symbol;Acc:2584]
Mouse Orthologue:
Cyld
Mouse Description:
cylindromatosis (turban tumor syndrome) Gene [Source:MGI Symbol;Acc:MGI:1921506]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa33993 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33993
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098879 Essential Splice Site 82 251 3 7
ENSDART00000130859 Essential Splice Site 20 188 1 5
Genomic Location (Zv9):
Chromosome 7 (position 1615030)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 1315962
GRCz11 7 1451952
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCATTCTGCCCTCACTGACCCTCGACATCACAGACTTGCTGGACGAGA[G/A]TGAGCATATAGACTGTTTTATTTATGGTTTATTTTTCACCTTAATAACTG
Associated Phenotype:
Not determined