Busch Lab

ZMP

ralgps1

Ensembl ID:
ENSDARG00000068370
ZFIN ID:
ZDB-GENE-070720-16
Description:
Ras-specific guanine nucleotide-releasing factor RalGPS1 [Source:UniProtKB/Swiss-Prot;Acc:B0UXH6]
Human Orthologue:
RALGPS1
Human Description:
Ral GEF with PH domain and SH3 binding motif 1 [Source:HGNC Symbol;Acc:16851]
Mouse Orthologue:
Ralgps1
Mouse Description:
Ral GEF with PH domain and SH3 binding motif 1 Gene [Source:MGI Symbol;Acc:MGI:1922008]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa38701 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17125 Essential Splice Site Available for shipment Available now
sa1127 Essential Splice Site F2 line generated Not yet available
sa38700 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2479
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098840 Essential Splice Site None 581 2 21
Genomic Location (Zv9):
Chromosome 8 (position 33951014)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 33093740
GRCz11 8 33102972
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGCCATGCAGATATTAGCCATGTGAAAGATCTGGCCAATCAAAATGGG[T/A]ATGCAAATCCATACGTTACACTAAAAMGTGTTATGTGTACAAATCAGTTT
Long Flanking Sequence:
CAGCCCAGTCACCAGATATAAACATTATTGAGCATGTCTGGGGTAAAATTATGAGGCATTGAAGATGAATCTAAAGAATCTTGATGAACTCTTGGAGTCCAAATGATTAACTAGAAATTATTATTTGTTGTTCCAAAAACTTGGATAGGTGATAAGACTTTTGTCAGGTTGTGTACATTGACATAAATAAATTAGTAATAATAATAAAACAATAGTAGTAGTATAGTAGCCTATACTAATTTAAATCCTTTTTTCTGTATATTAAACATCCTCATGCAAACACAGAGATCAGCATTGATGATTTGTTAGTACTCCCTGATAAATGCTTTGTGTTTTAATCTTAAATGTCTAGGTTATTGAGCTTGTAATCTTTGTAATTGAGCTTATAATCGTTCTCTTTCTTTTTTCAGTATCACTAAAGAACCACTGCTTGGGATGGACTTCACCAGCACTGCCATGCAGATATTAGCCATGTGAAAGATCTGGCCAATCAAAATGGG[T/A]ATGCAAATCCATACGTTACACTAAAAAGTGTTATGTGTACAAATCAGTTTTATGATTTCTGTACTATCATAATATGATTGTTTTATTTTATTGTTGTCATTTTATTACTGCTGCTTCCTTTTACGGTTTCATTACAGTTTTCATTGCTCAATATGTACACTTTGACACTCTCCTTATGATATGTCATATCATTTTAAGATGGAATGGCTGGCTGGATGAAAGTAGGGCAGATGCAGGAGTCATGCTGAGGGCGGAAAAAGGCTGCCTTTATGGCGCACACCTCCCTCTACTGGCTAAATTATGCATTGCTCATAATAAGGCTAGTTCATAAAATAAAGTGTTAAGCCATAATTACAGTATGGTAATATAAATATAAAAAAGTAATTTCAATCTATTTCAAATATTCCCAGTTGGACATAAAATAAAATGAAATGTGTGTCTATATGTGTGTTTCACTTTCAGGGATGGCTGAGAGGTTGTGTGTGGCGGTGAGCAGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38701
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098840 Essential Splice Site 71 581 5 21
Genomic Location (Zv9):
Chromosome 8 (position 33940630)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 33083356
GRCz11 8 33092588
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGATCACTTTGATGGATGCTCCTGTGTTCAAAGCGATCCAGCCTGAGG[T/C]AAGAGCGTTGTCCATGGCAACTAAATACACATCCTCTGTGTTTATGGAGC
Long Flanking Sequence:
TCAAGGGAAGCCTTTAATTACCCATTCAATTTTTATATTTATAGAAACCCACTTATTTCCAATAAAGGTCATTATGTAACATTTTTCACTGTAAAAAAGTTTCACTTTTAAGAAATCAGTAGAATGTTTGTAAAATACAATCAAAACTTGACACTTATGTGAGATAAAGACCCATTCTATAATCCCATAATGTAATAGTTTACCCACTATCAACGTTTACATTTTCCCTGTAGAAAATAAGGATGACATGTCACGGCACTGGATTTGGTCCACTTTTTTTAAATAAATCCAAGCAGCATGGATATTCTTCTAAATATATCATTTTGTGTTCTATGGAATAAAATCACACATGTTTGGAACAGTGTTCAATTATGGTACAGTGCTTATTTTTAAGTGTCATTTTTAAACTGCATATACAACTTTTTACCCTTTCTCATTTATTTTGCAGAGTCAGATCACTTTGATGGATGCTCCTGTGTTCAAAGCGATCCAGCCTGAGG[T/C]AAGAGCGTTGTCCATGGCAACTAAATACACATCCTCTGTGTTTATGGAGCCACAGCTGTAAACTGATCTCATGTGCTCTCTAGTGCTCCAGCGTAGTGTGACGTGGCACTACAGCAGTGCATTAATGGCACACATACACACTCAGACAGCAGTGCCCACAGCATTGAACTACACATTCTTCCATTACTTTAACCAGAGCTTACCCTCTGCTCTGAGTTACCGAGCCCTCAGTACTTTCCTTAATTAACATTTTATGTGAAGACGACAATGGAACGGCGCTCATAACAGATATGATAGGTTTGGACCAGGATCAGAGAGATGTTTTTACACAGATAATGAAAACACGTCAGCCAATGCATGTTACAGTTTAATACAGGTTTTGTGAGTGACTGCTTTCAGAGGAATTTTTATTTATTTATTTAAAGTATTTAGTGGGCAGCATGGTGGTGCAGTGGGTAGCACGATCGCCTCACAGCAAGAAGGTTGCTGGTTCGAGCCCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3669
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098840 Nonsense 227 581 10 21
Genomic Location (Zv9):
Chromosome 8 (position 33797606)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32940332
GRCz11 8 32949564
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTACATTGACTCCGCCTACCCTGCTTCTGACAGCATCATCGAGACAGAG[C/T]AAAGAACCAATCAGATGAACAATCTACTCCGCATCATTTCCGATCTACAG
Long Flanking Sequence:
GAATTTTAGTAGTAAAAATGTGTATGAACCCTCTATGTATCTATTTTATTTTCATTTGATGTCAGGCCTCCCATGGACAGGTGTTGAGAGTTAGCAAGTCTGCTGAAACACTTAAACAAATGCATTTGGTTATCCAGTGGGATGTCCATGTCAAAATAAATAAATAAATGATGTAATGTGTTTTATCTGGATTTTTTATCTTGGAATAGCCATATGTTCATAATGTGGTAATAAATGAATTTTTAAAAATGGTGCTTTGGCTTCATTTTTAAATTGTGAACACTTAAGTTTCCAATTATTGGGCTTTTTATGGAAAGAATTGACCAAGACATTATTATAATTTTGTGTTACCATTTAAGAGAAACTGTTAATGTTGACAATTTCCACGTCATCCAATTCCTGACCATTTTTCTTTTCTGTTTACATCAGGAATTTACCTGTTTGACATGACCTACATTGACTCCGCCTACCCTGCTTCTGACAGCATCATCGAGACAGAG[C/T]AAAGAACCAATCAGATGAACAATCTACTCCGCATCATTTCCGATCTACAGGTGTCCTGTAAATATGGTACGGTTCAGCTTTTAGAACTATGCTGGCAACTTATTCTTTGCGATTTGCTTTTTTAATAACATATGAAATGACTTTGTCTTTAAAACACTAATGAAAGCAAATCAGAAATATTGAAATATAATGATTTAAAGACCATCTCCATGTTTCATGACCCCATAGATCATTTAATCACGCTGCCCCACGTGCAGAAGTATCTGATGTCTGTGCGCTACATCGAGGAGCTCCAGAAGTTTGTGGAGGATGACAATTACTCGTAAGTGACATAAACCCATTATTATGCTCAGTAGCTTTAATTTAGCTTGTTTTGGGTGATTTTTGCTTTGCTTTCTGCACTGCAATTTATAGGATTTCGTAAACATCTATGCCAACTTTCACTGAAACTACCCACATCTGTAAGACCCTCATAAATCAAGACCCTCCCATCTTGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17125
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098840 Essential Splice Site 280 581 11 21
Genomic Location (Zv9):
Chromosome 8 (position 33797282)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32940008
GRCz11 8 32949240
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCRCTACATCGAGGAGCTCCAGAAGTTTGTGGAGGATGACAAYTACTCG[T/C]AAGTGACATAAACCCATTATTATGCTCAGTAGCTTTAATTTAGCTTGTTT
Long Flanking Sequence:
CAAGACATTATTATAATTTTGTGTTACCATTTAAGAGAAACTGTTAATGTTGACAATTTCCACGTCATCCAATTCCTGACCATTTTTCTTTTCTGTTTACATCAGGAATTTACCTGTTTGACATGACCTACATTGACTCCGCCTACCCTGCTTCTGACAGCATCATCGAGACAGAGCAAAGAACCAATCAGATGAACAATCTACTCCGCATCATTTCCGATCTACAGGTGTCCTGTAAATATGGTACGGTTCAGCTTTTAGAACTATGCTGGCAACTTATTCTTTGCGATTTGCTTTTTTAATAACATATGAAATGACTTTGTCTTTAAAACACTAATGAAAGCAAATCAGAAATATTGAAATATAATGATTTAAAGACCATCTCCATGTTTCATGACCCCATAGATCATTTAATCACGCTGCCCCACGTGCAGAAGTATCTGATGTCTGTGCGCTACATCGAGGAGCTCCAGAAGTTTGTGGAGGATGACAATTACTCG[T/C]AAGTGACATAAACCCATTATTATGCTCAGTAGCTTTAATTTAGCTTGTTTTGGGTGATTTTTGCTTTGCTTTCTGCACTGCAATTTATAGGATTTCGTAAACATCTATGCCAACTTTCACTGAAACTACCCACATCTGTAAGACCCTCATAAATCAAGACCCTCCCATCTTGTAACGCTGCCCTTTTTTGAACAGCTGCCTATAGTATTTATTAAAATGTGCTGTCTGTGGGCTTTATGTCTTCTTGGTTTGGCTGCATGGACCACAGGCCGACAAAACACCTAATTTACCGGCCACAGCTGCACCAGCTTGGCATGGCTTTATGCTACAATATAATCCCTATTTCCTTTACCTCAGGCTTCATAAATGTGAAGCCCATAATATATTTTCCTACTACAGTCTTATATAATATGGTTACCTTCAAGGAAAATGTGCCGTACACATGTGGTGAGGTATGATGAATTAAATGTTGTGAATGAAAACAGAATTATTAAAGTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1127
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098840 Essential Splice Site 413 581 15 21
Genomic Location (Zv9):
Chromosome 8 (position 33778444)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32921170
GRCz11 8 32930402
KASP Assay ID:
554-1038.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGTAGAGAGAGCTCTTTTAGTGATGAATTATCAAGTACTGTTGAGAGG[T/C]AAGGCCAATTAAAGATTATTATGAATCAGAATAKAAGATTGATTGATTTA
Long Flanking Sequence:
CAGTTTGGTGTTGTGGAGAGTAAAAGTGCAACATTTCCTGAAAAGGAAAAGGCTCGACACCTACTGGATGACAGCTTCTTAGAGTCTCACAGTCCTGTCAGAAACCATACACATGATTCAGTATTCACCAACGGCATATCACTGGGTAATGCAGTTAATTCCTGTTTTACACCCTTTTCATAAAGCACAAGTATCCGTGTCCTTGTTTTAAAGCATTTTATTTACTTCTACATCACTACTGTGTTGGAATATTTTTGCATCAAAAGCGAATGATTTCAACACTAGATGGCGGCAGTGTTAAATCATTTGTGCAGTGGGTTATTTTCTTTTGCAGCCCAGCAGACTTGAAATCTTTACCATGTGATGTTCCTGGGATTGTTTATTTTAGTTATTGAAGGAGAAAACAAATAATTGAATCTTACTCTTTATTTTTCCTCTGTCCCTCTGCAGGCAGTAGAGAGAGCTCTTTTAGTGATGAATTATCAAGTACTGTTGAGAGG[T/C]AAGGCCAATTAAAGATTATTATGAATCAGAATATAAGATTGATTGATTTAAGTCATTTTACCAAACAAAGTAATGTGTGTATCTGTCCTGATTGCTTTCAGAGGCCGAATGTATGCAACACTTGGCCCAAATTGGCGTGTCCCAATATGTAACTCTCCTAGAAGTAGAAGCTACATTTATAGGTATGAAATATTATTTTGTTCATTTTAAGTTGTTTATTTTGTGCCTATTAAGGACATAACAGAGGTTAATACTACTTCATTCAACAATCCAAGACCATAAACACTACAATTGTATCTTATTATGTAAGGAAGTGGTCACCAAACTTGTTTCTGGAGGGCCATTGTCCTGCAGATTTTTGCTCCAATCCTAATCAAACACACCTGAACAAGCTAATCAAGGTGTTAATAGGTATACTTGAAACATCCAGGCAGGTGTGTTGAAGCAAGTTGGAACTAAACCCTGCAGGGACACTGGCCCTCTAGGACAGAGATTGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38700
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098840 Nonsense 415 581 16 21
Genomic Location (Zv9):
Chromosome 8 (position 33778338)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32921064
GRCz11 8 32930296
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTACCAAACAAAGTAATGTGTGTATCTGTCCTGATTGCTTTCAGAGGC[C/T]GAATGTATGCAACACTTGGCCCAAATTGGCGTGTCCCAATATGTAACTCT
Long Flanking Sequence:
ATACACATGATTCAGTATTCACCAACGGCATATCACTGGGTAATGCAGTTAATTCCTGTTTTACACCCTTTTCATAAAGCACAAGTATCCGTGTCCTTGTTTTAAAGCATTTTATTTACTTCTACATCACTACTGTGTTGGAATATTTTTGCATCAAAAGCGAATGATTTCAACACTAGATGGCGGCAGTGTTAAATCATTTGTGCAGTGGGTTATTTTCTTTTGCAGCCCAGCAGACTTGAAATCTTTACCATGTGATGTTCCTGGGATTGTTTATTTTAGTTATTGAAGGAGAAAACAAATAATTGAATCTTACTCTTTATTTTTCCTCTGTCCCTCTGCAGGCAGTAGAGAGAGCTCTTTTAGTGATGAATTATCAAGTACTGTTGAGAGGTAAGGCCAATTAAAGATTATTATGAATCAGAATATAAGATTGATTGATTTAAGTCATTTTACCAAACAAAGTAATGTGTGTATCTGTCCTGATTGCTTTCAGAGGC[C/T]GAATGTATGCAACACTTGGCCCAAATTGGCGTGTCCCAATATGTAACTCTCCTAGAAGTAGAAGCTACATTTATAGGTATGAAATATTATTTTGTTCATTTTAAGTTGTTTATTTTGTGCCTATTAAGGACATAACAGAGGTTAATACTACTTCATTCAACAATCCAAGACCATAAACACTACAATTGTATCTTATTATGTAAGGAAGTGGTCACCAAACTTGTTTCTGGAGGGCCATTGTCCTGCAGATTTTTGCTCCAATCCTAATCAAACACACCTGAACAAGCTAATCAAGGTGTTAATAGGTATACTTGAAACATCCAGGCAGGTGTGTTGAAGCAAGTTGGAACTAAACCCTGCAGGGACACTGGCCCTCTAGGACAGAGATTGGTGACCCCTGATGTAAGTAATAAAATACATCCAAGCCGTCGTTACCAGATTAAAGGCTGACAAGCTTATTGGCAGCCCAACACAAAGTCGGGGGATGTTGTATTCATCTT
Associated Phenotype:
Not determined