Busch Lab

ZMP

si:ch211-243k12.1

Ensembl ID:
ENSDARG00000068247
ZFIN IDs:
ZDB-GENE-060503-278, ZDB-GENE-091113-29
Description:
Leucine zipper protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A5D8S1]
Human Orthologue:
LUZP2
Human Description:
leucine zipper protein 2 [Source:HGNC Symbol;Acc:23206]
Mouse Orthologue:
Luzp2
Mouse Description:
leucine zipper protein 2 Gene [Source:MGI Symbol;Acc:MGI:1889615]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa36700 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36700
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111301 None None 311 None 11
ENSDART00000146120 Nonsense 276 346 10 12
Genomic Location (Zv9):
Chromosome 18 (position 36285434)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37867137
GRCz11 18 37848145
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCGGATCACAACAACAAGTAAATTGCCTGTGAGCAGTGCGGTAATGAGG[A/T]GAGAGAGCACGGGGCCCAAAGACTGCCAGATGGTGAAGGTAAATCTTTAG
Associated Phenotype:
Not determined