Busch Lab

ZMP

COL25A1 (1 of 2)

Ensembl ID:
ENSDARG00000068218
Description:
collagen, type XXV, alpha 1 [Source:HGNC Symbol;Acc:18603]
Human Orthologue:
COL25A1
Human Description:
collagen, type XXV, alpha 1 [Source:HGNC Symbol;Acc:18603]
Mouse Orthologue:
Col25a1
Mouse Description:
collagen, type XXV, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1924268]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa12148 Essential Splice Site Available for shipment Available now
sa14199 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27076
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074352 Nonsense 58 291 3 17
Genomic Location (Zv9):
Chromosome 7 (position 60515942)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59734907
GRCz11 7 60040144
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCAGGACCACCTGGAAAAGGTGAACGTGGTGAAACAGGTCCTTTAGGA[C/T]AGAAGGTAAAGTAAAAAAAAGGCATTTTTGCACTGGTCAGGAAAATTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12148
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074352 Essential Splice Site 74 291 4 17
Genomic Location (Zv9):
Chromosome 7 (position 60519908)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59738873
GRCz11 7 60044110
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAAGGGAGAGCAAGGGGAATCAGGAGCACCAGGCCTGAAAGGTTCAAAG[G/A]TCAGTMTCTGCTTCTTAGTGAACCATGCATTAGGAAMTTAAAAACAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14199
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074352 Essential Splice Site 89 291 5 17
Genomic Location (Zv9):
Chromosome 7 (position 60520123)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59739088
GRCz11 7 60044325
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACAGGGGGATTCAGGAGACAAAGGGGATGTGGGCCCAACAGGATCACAA[G/T]TGAGTAAAGTGTAAAATGATGTAYTTTTTTTTTGACAGGCAAATTTAACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27077
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074352 Essential Splice Site 218 291 12 17
Genomic Location (Zv9):
Chromosome 7 (position 60526875)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59745840
GRCz11 7 60051077
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCGGGCCCCCTGGAGCACCTGGTCCACAGGGACCACCTGGCCCAATGG[T/A]ACGTTAAAGTGAACATGCTTTGCACAACAAAACGGCATGTGAACACTCAT
Associated Phenotype:
Not determined