Busch Lab

ZMP

si:dkey-201c13.3

Ensembl ID:
ENSDARG00000068194
ZFIN ID:
ZDB-GENE-060526-244
Description:
hypothetical protein LOC565869 [Source:RefSeq peptide;Acc:NP_001122201]
Human Orthologue:
KLF9
Human Description:
Kruppel-like factor 9 [Source:HGNC Symbol;Acc:1123]
Mouse Orthologue:
Klf9
Mouse Description:
Kruppel-like factor 9 Gene [Source:MGI Symbol;Acc:MGI:1333856]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9385 Nonsense Mutation detected in F1 DNA Not yet available
sa40427 Nonsense Mutation detected in F1 DNA Not yet available
sa11647 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9385
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098473 Nonsense 33 216 1 2
Genomic Location (Zv9):
Chromosome 5 (position 27720212)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25475510
GRCz11 5 26075663
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGTCGAGCGCTCCGACAAACTAACCGGCGAGGAGGGGTCTGAAGAAAGT[C/T]AAGAAAGCCGGAYTCTGTTGATGGTCGCAATGATTCTGCTGGACTTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40427
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098473 Nonsense 48 216 1 2
Genomic Location (Zv9):
Chromosome 5 (position 27720258)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25475556
GRCz11 5 26075709
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTCAAGAAAGCCGGACTCTGTTGATGGTCGCAATGATTCTGCTGGACT[T/G]AAACCAGTGCATACCGAGCGGCATCAGCGCCAAGCGAATAGTGGACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11647
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098473 Nonsense 103 216 1 2
Genomic Location (Zv9):
Chromosome 5 (position 27720424)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25475722
GRCz11 5 26075875
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAKCGCGACCGACTGCACGCATCCGCGGAGAAAAGACACTGCTGCCCGTA[T/A]GCAGGCTGTGGTAAAATATACGGCAAGTCTTCCCATCTGAAGGCGCACTT
Associated Phenotype:
Not determined