Busch Lab

ZMP

cdh15

Ensembl ID:
ENSDARG00000068191
ZFIN ID:
ZDB-GENE-030131-780
Description:
cadherin-15 [Source:RefSeq peptide;Acc:NP_997771]
Human Orthologue:
CDH15
Human Description:
cadherin 15, type 1, M-cadherin (myotubule) [Source:HGNC Symbol;Acc:1754]
Mouse Orthologue:
Cdh15
Mouse Description:
cadherin 15 Gene [Source:MGI Symbol;Acc:MGI:106672]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11460 Nonsense Available for shipment Available now
sa695 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa11460
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098453 Nonsense 108 792 3 14
ENSDART00000127046 Nonsense 108 808 3 17
Genomic Location (Zv9):
Chromosome 7 (position 57394370)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55829696
GRCz11 7 56131107
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGAAATCGATRMWAAAACAGGATGGATYAAGAGCAAAGAGCCGCTGGAC[A/T]GAGAAAAACACAAGAGTTTTAAAGTAAGCATGTTTAGGCCAAGTACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa695
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098453 Essential Splice Site 661 792 12 14
ENSDART00000127046 Essential Splice Site 659 808 14 17
Genomic Location (Zv9):
Chromosome 7 (position 57404189)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55839515
GRCz11 7 56140926
KASP Assay ID:
554-0603.1 (used for ordering genotyping assays)
KASP Sequence:
GAGACAACGTCTTTCATTATGATGAGCAGGGAGGYGGAGAAGAGGATGAG[G/A]TAAGAKCATTGACACTACATTTAATAAAGCTATGGTAAAAAAATAAATAA
Associated Phenotype:
Not determined