Busch Lab

ZMP

trib2

Ensembl ID:
ENSDARG00000068179
ZFIN ID:
ZDB-GENE-091207-3
Human Orthologue:
TRIB2
Human Description:
tribbles homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:30809]
Mouse Orthologue:
Trib2
Mouse Description:
tribbles homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2145021]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa16440 Essential Splice Site Available for shipment Available now
sa23798 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16440
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098424 Essential Splice Site 188 343 2 3
Genomic Location (Zv9):
Chromosome 20 (position 45684504)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45533182
GRCz11 20 45423172
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCCTCCGAGACCTCAAGCTGAGGAAGTTCGTCTTCAAGAATGAGGACAG[G/T]TAATAMAGATGTCTGCTTGCAAACCGAACATGCATATTCTGACTAGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23798
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098424 Nonsense 327 343 3 3
Genomic Location (Zv9):
Chromosome 20 (position 45698771)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45547449
GRCz11 20 45408905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCCATCACTCCGGCCGTCAACCATGGAAGAAACGAACGGGAGTTGGAC[C/T]AAATGGTACCAGAGGCCAACATGGAAGAAGAACTAGAACAGTTCTTTAGC
Associated Phenotype:
Not determined