Busch Lab

ZMP

zgc:153206

Ensembl ID:
ENSDARG00000068176
ZFIN ID:
ZDB-GENE-060929-1034
Description:
ubiquinol-cytochrome c reductase complex chaperone [Source:RefSeq peptide;Acc:NP_001070223]
Human Orthologue:
UQCC
Human Description:
ubiquinol-cytochrome c reductase complex chaperone [Source:HGNC Symbol;Acc:15891]
Mouse Orthologue:
Uqcc
Mouse Description:
ubiquinol-cytochrome c reductase complex chaperone, CBP3 homolog (yeast) Gene [Source:MGI Symbol;Acc

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa26839 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa26839
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098421 Essential Splice Site 98 286 3 9
Genomic Location (Zv9):
Chromosome 6 (position 52510693)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52559946
GRCz11 6 52559072
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGATTGAGGCCATGGGCTTCACCGGACCCCTCAAATACAACAAATGGG[T/G]AAATAAAGCCGCTCATCCAGTGTTTCTAAGCAGTAGATGACATTTGGTAT
Associated Phenotype:
Not determined