Busch Lab

ZMP

si:ch211-215c18.4

Ensembl ID:
ENSDARG00000068122
ZFIN ID:
ZDB-GENE-060526-106
Description:
Uncharacterized protein FLJ46082 homolog [Source:UniProtKB/Swiss-Prot;Acc:A2BFC9]
Human Orthologue:
C9orf171
Human Description:
chromosome 9 open reading frame 171 [Source:HGNC Symbol;Acc:33776]
Mouse Orthologue:
1700101E01Rik
Mouse Description:
RIKEN cDNA 1700101E01 gene Gene [Source:MGI Symbol;Acc:MGI:2685669]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40458 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26495
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098323 Nonsense 178 209 4 5
ENSDART00000125586 Nonsense 178 221 4 5
ENSDART00000137400 Nonsense 197 240 6 7
ENSDART00000145021 Nonsense 197 240 6 7
Genomic Location (Zv9):
Chromosome 5 (position 31398463)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29159820
GRCz11 5 29759973
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGAAAGAGTCAGCCCTTGCCTGAGGCTCCGTCCACGTGGAAACTGCCT[C/T]GATTCCAGAAGGTGAAAACCACCAAGACTTTCACTTCTGTATTCTCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40458
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098323 None None 209 None 5
ENSDART00000125586 Nonsense 190 221 5 5
ENSDART00000137400 Nonsense 209 240 7 7
ENSDART00000145021 Nonsense 209 240 7 7
Genomic Location (Zv9):
Chromosome 5 (position 31391350)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29152707
GRCz11 5 29752860
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACTCTATGTTTTCGTATTCTGCAGGTGGGAGCGGCTCTGGACACCTTT[C/T]GAGATCCTGAAGCCCGGAAAAAAGCCATGAACGCCCACTGCTCTGAGTCT
Associated Phenotype:
Not determined