Busch Lab

ZMP

tmem119b

Ensembl ID:
ENSDARG00000068036
ZFIN ID:
ZDB-GENE-070410-49
Description:
transmembrane protein 119b [Source:RefSeq peptide;Acc:NP_001082912]
Human Orthologue:
TMEM119
Human Description:
transmembrane protein 119 [Source:HGNC Symbol;Acc:27884]
Mouse Orthologue:
Tmem119
Mouse Description:
transmembrane protein 119 Gene [Source:MGI Symbol;Acc:MGI:2385228]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa33634 Nonsense Mutation detected in F1 DNA Not yet available
sa16859 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26503
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098160 Nonsense 67 294 2 2
Genomic Location (Zv9):
Chromosome 5 (position 33510562)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31272794
GRCz11 5 31872947
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGCATCCCTTCCTTTCTCAATGACTCTGTGAAGTCCACCTCCATAGAT[G/T]GAGATAAACAAACCAAACCATTCTGGAATCAAGCAGCAGATTTTTTAAAA
Long Flanking Sequence:
GGCTGCACCTGGTCACTACCTGGAAGGGAGACCACATGTGAAAGCTAGGTTGCTGCTGGAATCAGTGTTAGTGAGGCCAGCAGGGGGTGCCCAACCTGTGGCCTGTGTGAGTCCTAACACCCCAGTAGAGTGAAAGAGACTCTGTACTGCTCAGTGAGCGTTGTCTTTTGGTTGAGATGTTAAACTGAAGTCCTGGTCTGAGGTTCTTCTCACAGAAAAACTACATGAGGGTTATACATGTGCAAAAATGAAAATGAAAAATGCTGTATGCTTTTTAATCACTGCAGGTATTGAGTCACAGGATGGATCACTCAGCTCTCCGCTGCCTCATCGGCCTGTCCATTGTTCTGCTAACCAAAAAGTACTCTAATGCCACCCCAGTCATTTTAAATGACTCTTGGGAGGGCAGTGGCCAGTGGTATTCTACGATCATAGATGTGGATTTCACACCCAGCATCCCTTCCTTTCTCAATGACTCTGTGAAGTCCACCTCCATAGAT[G/T]GAGATAAACAAACCAAACCATTCTGGAATCAAGCAGCAGATTTTTTAAAAGAGAACCACCTCCCCATAATCGTCATTACCACACTAATCCTTCTCATCTTCACCATCCTCTGCTCGGCTGCCATTTTGAGTCGCCGACGTAAAGTCAGCACCTACTACCCCTGTGCTTTTCCCTCAAAGATGTACGTGGATGAGCAAGACAAGGCTGGGGGAGGACGCTTCTTCAGCGAAGTCCCAGAAAAAACCAACACCAGCCCCAGTGAGGAGCCAGTGAATTCAGCCAGGCAGCTCCAGGAGGACATCATGATGGCCACCAAGAACCTCAGAACTCCACTCAAGAGTCCGTGGAAGGAGAAGAGTGAAGAGGCAGAAGCCCAAAAACCTGCAGAGGAGGAGGAAAGTCCTCTATGTGAGCTGAGTCAAGAGGAGAGCTGTGGTTTGCTGGAAGAAAATATCACAAATGAGTCTGTTGTTGATGATCCTGTGGAAAAGATCAGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33634
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098160 Nonsense 77 294 2 2
Genomic Location (Zv9):
Chromosome 5 (position 33510532)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31272764
GRCz11 5 31872917
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGTCCACCTCCATAGATGGAGATAAACAAACCAAACCATTCTGGAAT[C/T]AAGCAGCAGATTTTTTAAAAGAGAACCACCTCCCCATAATCGTCATTACC
Long Flanking Sequence:
ACCACATGTGAAAGCTAGGTTGCTGCTGGAATCAGTGTTAGTGAGGCCAGCAGGGGGTGCCCAACCTGTGGCCTGTGTGAGTCCTAACACCCCAGTAGAGTGAAAGAGACTCTGTACTGCTCAGTGAGCGTTGTCTTTTGGTTGAGATGTTAAACTGAAGTCCTGGTCTGAGGTTCTTCTCACAGAAAAACTACATGAGGGTTATACATGTGCAAAAATGAAAATGAAAAATGCTGTATGCTTTTTAATCACTGCAGGTATTGAGTCACAGGATGGATCACTCAGCTCTCCGCTGCCTCATCGGCCTGTCCATTGTTCTGCTAACCAAAAAGTACTCTAATGCCACCCCAGTCATTTTAAATGACTCTTGGGAGGGCAGTGGCCAGTGGTATTCTACGATCATAGATGTGGATTTCACACCCAGCATCCCTTCCTTTCTCAATGACTCTGTGAAGTCCACCTCCATAGATGGAGATAAACAAACCAAACCATTCTGGAAT[C/T]AAGCAGCAGATTTTTTAAAAGAGAACCACCTCCCCATAATCGTCATTACCACACTAATCCTTCTCATCTTCACCATCCTCTGCTCGGCTGCCATTTTGAGTCGCCGACGTAAAGTCAGCACCTACTACCCCTGTGCTTTTCCCTCAAAGATGTACGTGGATGAGCAAGACAAGGCTGGGGGAGGACGCTTCTTCAGCGAAGTCCCAGAAAAAACCAACACCAGCCCCAGTGAGGAGCCAGTGAATTCAGCCAGGCAGCTCCAGGAGGACATCATGATGGCCACCAAGAACCTCAGAACTCCACTCAAGAGTCCGTGGAAGGAGAAGAGTGAAGAGGCAGAAGCCCAAAAACCTGCAGAGGAGGAGGAAAGTCCTCTATGTGAGCTGAGTCAAGAGGAGAGCTGTGGTTTGCTGGAAGAAAATATCACAAATGAGTCTGTTGTTGATGATCCTGTGGAAAAGATCAGCCCCAGCAGGTCCCAGGACGATGTCCCATCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16859
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098160 Nonsense 193 294 2 2
Genomic Location (Zv9):
Chromosome 5 (position 33510184)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31272416
GRCz11 5 31872569
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCCACTCAAGAGTCCGWGGAAGGAGAAGAGTGAAGAGGCAGAAGCCCAA[A/T]AACCTGCARAGGRGGAGGAAAGTCCTCTATGTGAGCTGAGTCAAGAGGAG
Long Flanking Sequence:
CAGTCATTTTAAATGACTCTTGGGAGGGCAGTGGCCAGTGGTATTCTACGATCATAGATGTGGATTTCACACCCAGCATCCCTTCCTTTCTCAATGACTCTGTGAAGTCCACCTCCATAGATGGAGATAAACAAACCAAACCATTCTGGAATCAAGCAGCAGATTTTTTAAAAGAGAACCACCTCCCCATAATCGTCATTACCACACTAATCCTTCTCATCTTCACCATCCTCTGCTCGGCTGCCATTTTGAGTCGCCGACGTAAAGTCAGCACCTACTACCCCTGTGCTTTTCCCTCAAAGATGTACGTGGATGAGCAAGACAAGGCTGGGGGAGGACGCTTCTTCAGCGAAGTCCCAGAAAAAACCAACACCAGCCCCAGTGAGGAGCCAGTGAATTCAGCCAGGCAGCTCCAGGAGGACATCATGATGGCCACCAAGAACCTCAGAACTCCACTCAAGAGTCCGTGGAAGGAGAAGAGTGAAGAGGCAGAAGCCCAA[A/T]AACCTGCAGAGGAGGAGGAAAGTCCTCTATGTGAGCTGAGTCAAGAGGAGAGCTGTGGTTTGCTGGAAGAAAATATCACAAATGAGTCTGTTGTTGATGATCCTGTGGAAAAGATCAGCCCCAGCAGGTCCCAGGACGATGTCCCATCTTGTGACATGGAAAAGACTGACCTCTCGGACTCTGGGCCCCCTGATGAGAGCAAACATCCATCTGGGCTAGAGAATTCTGAGATACAAGAGGACACGAACAAACAGGAAGTCACTACTTCAGGCTCTCCATTCATCAGCAAAGAGAAAACAGCATTTTAATGTGGACATTTTAAAAGCCTTGAAGGAAACACAAGTACAGAGCAAACTGTGTTTTTTGGACATTGTAAAAGTGAAGAATGTGGTATGAGGTTTCATGATTTTCCCAAAAGTTTGTATGGCTTTATTGTTGTTTCTGACTGTTTACTTTCATGTAACATATGTAATCTGTTTTGAATCGCTATTTTAAATGCT
Associated Phenotype:
Not determined