Busch Lab

ZMP

LOC100332016

Ensembl ID:
ENSDARG00000068019
Human Orthologue:
SOX8
Human Description:
SRY (sex determining region Y)-box 8 [Source:HGNC Symbol;Acc:11203]
Mouse Orthologue:
Sox8
Mouse Description:
SRY-box containing gene 8 Gene [Source:MGI Symbol;Acc:MGI:98370]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10674 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10674
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098117 Nonsense 88 414 2 4
Genomic Location (Zv9):
Chromosome 12 (position 1289378)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 1152686
GRCz11 12 1084912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCGCAGGWCCTGAAGGGCTACGACTGGTCCCTRGTGCCGATGCCGATG[C/T]AGGGAAGTCGGTCWCTGAAGGACAAACCGCACGTGAAGAGACCCATGAAC
Long Flanking Sequence:
ATAAGCAGTTATACAGCATTATGCTGTAATTTGTAGTCAATTATGTTCAATTAAGTTAAAAAGTTGCTGATGTGCAGAACTGGCCAATCAGAGCAGTTGCGTAAAATAATCTCGACCAATGAGAAAACAGAAGGAGGAGACTATTAATAATGCCGCACAAAACTTCTCTCTCACCAATAAGTTGTGTAATGTTGCCAGTTCCTCAGCCCGACGCGTCATGAAACCGAACAATTAGTGCGCTTATTGGGAATACTTCTGTGAGATCGCAGGATTTTAAAATGTCTAAGGAGCCGGATAAAGCTGCTTCTATCCCGGAGAGTTGTTTTCTGGATGATGTGGACTCTGATTCTCCGTCTTCTCCATCTGTGTCTGATGATCCAGGCTCGCGCGCCGCTCCGCCACCGGACACCGATGGAGACGCGCGGTTCCCTGTGTGCATCCGAGACGCGGTGTCGCAGGTCCTGAAGGGCTACGACTGGTCCCTGGTGCCGATGCCGATG[C/T]AGGGAAGTCGGTCTCTGAAGGACAAACCGCACGTGAAGAGACCCATGAACGCGTTTATGGTGTGGGCGCAGGCGGCGCGGAGGAAACTCGCCGATCAGTACCCGCATCTGCACAACGCGGAGCTCAGCAAGACCCTCGGGAAGCTCTGGAGGTACTGATTAATGCATGTGTTTTATAATAAACACTTATTCTGAAACTGCGATGCAAACTTTTTTTTTATGCAATAATATTTTGATTAATTTGTCAGTGAATATAGGCAATAATATTTGGTGCATTCAAACAAAACAGTTTTATTAAACAGTTATAGGCTTATTCATTAAAACAAGTCACCGAACATCTTTAGGAATAGAAAGTTAATGCAAAATAGAAATTATGAATAGATATAAATATATAAAGTACACAATTCCAACTAAATTTTTCCTGTTTATCAAATTTTTATTGAATACTTTTCCCCAACATATTAATTTCTGCTTATTTAGACTGTACCCTTCAGGGTTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7682
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098117 Nonsense 168 414 3 4
Genomic Location (Zv9):
Chromosome 12 (position 1286209)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 1149517
GRCz11 12 1081743
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCWGAAAGACTGAGGCTGCAGCATAAGAAAGACTATCCTGATTATAAATA[T/A]CAGCCRCGGAGACGCAAGAGTCTAAAACCTGGACAGAATGAAGCAGAAGC
Long Flanking Sequence:
CATGCTTCAAGTGATGTCACTGTGGAAGGCAATGTTTATGATACACCAATAGTAGATTGATTATGTCAACTCTGTTACTGTGATATTAGAGTTAATGTATTGAATTGATTGTGTTTTAGACGCGCCATATGGAGTCTGGGTTGAGGTTAGCATCTAGAGCTAAAGCTCAAAAGGATGGAGAATGTCAACTTTGTTATTATCATTGTTAAGCTAAGCAACAATTAGCAATCAAATCAAATGTTCTCTATCATGCATTATTTTACATGAATAACGCATTCAGTCTAGTGTAAATGATGCATTTGTAGTGCATCAGGATAATGAAGTGCACCCTCAATTTGACATGAATAACAGATGCAGTTTACTGTTAATGATATTATATTGAATGATATTACTGTCCTCTGTTTGCTCAGGCTGTTGTCTGAGAGCGAGAAGAGGCCGTTTGTGGAAGAAGCTGAAAGACTGAGGCTGCAGCATAAGAAAGACTATCCTGATTATAAATA[T/A]CAGCCGCGGAGACGCAAGAGTCTAAAACCTGGACAGAATGAAGCAGAAGCAGGAGCCGAGAAAAACCTTCATCACACGGATCCAATCTACAAGACGGAAGCGGGAATGAGAGCCATGCACCATCAGACCATCCATGGAGGTCAGATAATGCACATTTATTATAATAATAATAATAATACTTTTAATTTTCCGTGAGCCAGCTCAAGTGTTTGGTAAACTGTCATGTCATTATAAACGTACCACGTTTAGGATCTTGTTTCTTTTAAAAAAGGTTTGATCTTCACCGCACTCAAGAGTATTGATGCTTGTTCAAATTAAAATAAGCAAAAATAAAACAATCCTTGAGTTTTTTGGGAAGACTTAACTGTTTTATGTTCAATCCACTTACAAGTTGACTTAATCAATGTGTTTTTGGACAGTATGAATGTATTGTGTGGAACCCAGCATTTTGTATTGTGTGCCTGATTGAAAACTGCAATAGATTACATTGTTCTGCATCA
Associated Phenotype:
Not determined