Busch Lab

ZMP

myhz1.3

Ensembl ID:
ENSDARG00000067997
ZFIN ID:
ZDB-GENE-070705-74
Description:
Novel myosin family protein [Source:UniProtKB/TrEMBL;Acc:B8A569]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa20463 Nonsense Available for shipment Available now
sa10927 Essential Splice Site Available for shipment Available now
sa40477 Nonsense Mutation detected in F1 DNA Not yet available
sa6057 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5302
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122889 Nonsense 355 1937 12 41
ENSDART00000127125 None None 423 None 9
ENSDART00000130531 Nonsense 355 790 12 21
Genomic Location (Zv9):
Chromosome 5 (position 33909490)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31671722
GRCz11 5 32271875
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCTATCGACATTCTGGGCTTCAATGCTGAAGAGAAAATGGGCATCTAC[A/T]AGTTTACWGGAGCTGTGCTTCATCATGGTAACATGAAGTTCAAGCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20463
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122889 Nonsense 409 1937 13 41
ENSDART00000127125 None None 423 None 9
ENSDART00000130531 Nonsense 409 790 13 21
Genomic Location (Zv9):
Chromosome 5 (position 33909193)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31671425
GRCz11 5 32271578
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGTTTGAACTCTGCTGATATGCTTAAGGCTTTGTGTTACCCCAGAGTC[A/T]AGGTCGGAAATGAGTTTGTGACCAAAGGACAGACTGTGCCACAGGTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10927
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122889 Essential Splice Site 723 1937 19 41
ENSDART00000127125 None None 423 None 9
ENSDART00000130531 Essential Splice Site 723 790 19 21
Genomic Location (Zv9):
Chromosome 5 (position 33907635)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31669867
GRCz11 5 32270020
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAGAAAGGGTTTCCCCAGCAGAATCCTCTATGGTGACTTCAAGCAGAG[G/T]TAAATGGGACTTTATGAAAATGTAATTTACTGTAAGAGTCAATTTAAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1874
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122889 Nonsense 1037 1937 25 41
ENSDART00000127125 None None 423 None 9
ENSDART00000130531 None None 790 None 21
Genomic Location (Zv9):
Chromosome 5 (position 33906068)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31668300
GRCz11 5 32268453
KASP Assay ID:
554-1864.1 (used for ordering genotyping assays)
KASP Sequence:
AATTTGAGCACCTAATTTATGTCATGTCAACTTTACAAATAACTTAGCTG[G/T]AAGGTTCCCTTGAGCAAGAGAAGAAGCTCCGTATGGACCTGGAGAGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40477
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122889 Nonsense 1744 1937 36 41
ENSDART00000127125 Nonsense 230 423 4 9
ENSDART00000130531 None None 790 None 21
Genomic Location (Zv9):
Chromosome 5 (position 33901240)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31663472
GRCz11 5 32263625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACCAAGAAGAAGCTTGAGGCTGACCTTGTTCAGATCCAGAGTGAAGTT[G/T]AAGACACTGTACAGGAAGCCAGAAATGCAGAGGAGAAGGCCAAGAAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6057
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122889 Nonsense 1876 1937 39 41
ENSDART00000127125 Nonsense 362 423 7 9
ENSDART00000130531 None None 790 None 21
Genomic Location (Zv9):
Chromosome 5 (position 33900549)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31662781
GRCz11 5 32262934
KASP Assay ID:
554-3885.1 (used for ordering genotyping assays)
KASP Sequence:
ACAAGAAGAATGTCAACAGGCTGCAGGATCTGGTTGATAAGCTTCAGCTG[A/T]AGGTCAAGGCTTMCAAGAGACAGTCTGAAGAAGCTGTGAGTTCCTCATTT
Associated Phenotype:
Not determined