Busch Lab

ZMP

gas1b

Ensembl ID:
ENSDARG00000067984
ZFIN ID:
ZDB-GENE-050302-79
Description:
growth arrest-specific 1b [Source:RefSeq peptide;Acc:NP_001071269]
Human Orthologue:
GAS1
Human Description:
growth arrest-specific 1 [Source:HGNC Symbol;Acc:4165]
Mouse Orthologue:
Gas1
Mouse Description:
growth arrest specific 1 Gene [Source:MGI Symbol;Acc:MGI:95655]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa31461 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31461
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098045 Nonsense 151 263 1 1
Genomic Location (Zv9):
Chromosome 5 (position 34000144)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31762376
GRCz11 5 32362529
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCAAGCAGTGCGAGAAGGACCCCGAGTGCAAGACCGCCATGCTGGACTA[T/A]CTGTACCACTGCAGGAAACTTTTCGGAGGAAACCGCTGCTCGGACGACTG
Long Flanking Sequence:
CAGCAAATGGAAACATTTGATCCAGAAAGTTAACTTTTAAGCTGTTGCATGCGGGCACATGAAGGAATGGCAAACTCTGGCAACTCAGTCACTCCCTGCCTGTGGATATTGTTTTTGTCCATCGGCATTGTGTTCTTTAATGCTTTATCCACCGCGTCTCCGACACACAACCAGCGTTTGATATGCTGGCAGGCTATCATGAAGTGCCAAGGAGAGCCTGATTGTCATTACGCGTATACTCAGTATGTTCACGCGTGCGATCCGGTGATAAAGGGCAACAAGAAGGTATGTCCCAGCCACTGCATTTCTTCCATCATTCAGCTCAACCTAACAGTGAACGGCCCTGCACTGGAGGACTGCGAATGCGCCTCGGACACGGTGTGTATGATGACTAAGCGAGCCATCGAGCCCTGCATGCCCAGGACCAGCCACATGGGCTGCACCGAAGCCCGCAAGCAGTGCGAGAAGGACCCCGAGTGCAAGACCGCCATGCTGGACTA[T/A]CTGTACCACTGCAGGAAACTTTTCGGAGGAAACCGCTGCTCGGACGACTGCCGGACGCTCATCGCCAACATGCGCTCCAACCCCAAAGCACAGCTCCTGGACACCTGCGTGTGCGACGGTAACGAAAGGACCACATGCGAGTATGTCAAATTCAGCATGAAAAACTTATGCTTTGGCGACGGTTATGGCGGGAGTGGCTTTTCAGATACCGAGGACGATTTGGAGGAAGACTACGAGATGGATTATGAGGACGAAGCGAGCCATGCCCGGGAGTTACGAACACAAACGAGTTTGATTGTGTTGTCCACCATTTTGACCTTTTTTCTTGTACTGTATTAAGATACTGTTTTCATAATTTGGCCTCTGAAACTTGTTCCCATCACAAATAATCGGGCTAAATTTAAAATTCAATTTTAATCTCATACTTCCCTCAATGCAACATCTCAACGTTTTGACCTTTCTTCTCAGAAAAAAACTATATAAAACTTTATAAAAAGAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3526
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098045 Nonsense 244 263 1 1
Genomic Location (Zv9):
Chromosome 5 (position 33999867)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31762099
GRCz11 5 32362252
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGACTACGAGATGGATTATGAGGACGAAGCGAGCCATGCCCGGGAGTTA[C/T]GAACACAAACGAGTTTGATTGTGTTGTCCACCATTTTGACCTTTTTTCTT
Long Flanking Sequence:
ACAAGAAGGTATGTCCCAGCCACTGCATTTCTTCCATCATTCAGCTCAACCTAACAGTGAACGGCCCTGCACTGGAGGACTGCGAATGCGCCTCGGACACGGTGTGTATGATGACTAAGCGAGCCATCGAGCCCTGCATGCCCAGGACCAGCCACATGGGCTGCACCGAAGCCCGCAAGCAGTGCGAGAAGGACCCCGAGTGCAAGACCGCCATGCTGGACTATCTGTACCACTGCAGGAAACTTTTCGGAGGAAACCGCTGCTCGGACGACTGCCGGACGCTCATCGCCAACATGCGCTCCAACCCCAAAGCACAGCTCCTGGACACCTGCGTGTGCGACGGTAACGAAAGGACCACATGCGAGTATGTCAAATTCAGCATGAAAAACTTATGCTTTGGCGACGGTTATGGCGGGAGTGGCTTTTCAGATACCGAGGACGATTTGGAGGAAGACTACGAGATGGATTATGAGGACGAAGCGAGCCATGCCCGGGAGTTA[C/T]GAACACAAACGAGTTTGATTGTGTTGTCCACCATTTTGACCTTTTTTCTTGTACTGTATTAAGATACTGTTTTCATAATTTGGCCTCTGAAACTTGTTCCCATCACAAATAATCGGGCTAAATTTAAAATTCAATTTTAATCTCATACTTCCCTCAATGCAACATCTCAACGTTTTGACCTTTCTTCTCAGAAAAAAACTATATAAAACTTTATAAAAAGAGTTTATATAGTTGTAAATTTCAAGTTGTGCTATTTATTTGGTTTGTATTGTTTTTATTTAGGACTCTAAACTTACATTTCACACTTTAGCCTACGTTAGTCTTGTGAGATATAACTCGGATTTGTGAGAAATAAACCCAGAATTATGAGAACGCAAACTCACAATTGTGAGAAATATATTTACAATACAGAAGGAAAAATGTTTAGACTCATTAAGAGTAGTTAACTAGAAGTAAAATTGGCAAGAAAATTGATATTATGCAAAAAAAAAGTAAGAATT
Associated Phenotype:
Not determined