Busch Lab

ZMP

scospondin

Ensembl ID:
ENSDARG00000067859
ZFIN ID:
ZDB-GENE-051114-1
Description:
Subcommissural organ spondin [Source:UniProtKB/TrEMBL;Acc:A3KPT1]
Mouse Orthologue:
Sspo
Mouse Description:
SCO-spondin Gene [Source:MGI Symbol;Acc:MGI:2674311]

Alleles

There are 19 alleles of this gene:

Allele Name Consequence Status Availability
sa17228 Nonsense Available for shipment Available now
sa16303 Essential Splice Site Available for shipment Available now
sa13835 Splice Site, Nonsense Available for shipment Available now
sa44197 Nonsense Mutation detected in F1 DNA Not yet available
sa30152 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37962 Nonsense Mutation detected in F1 DNA Not yet available
sa24566 Nonsense Available for shipment Available now
sa37963 Nonsense Mutation detected in F1 DNA Not yet available
sa24567 Nonsense Available for shipment Available now
sa1281 Essential Splice Site Available for shipment Available now
sa45840 Nonsense Mutation detected in F1 DNA Not yet available
sa3255 Essential Splice Site F2 line generated Not yet available
sa24568 Essential Splice Site Available for shipment Available now
sa8859 Nonsense Mutation detected in F1 DNA Not yet available
sa37964 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37965 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5089
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Splice Site, Nonsense 282 4661 6 94
ENSDART00000136590 Splice Site, Nonsense 282 899 7 19
Genomic Location (Zv9):
Chromosome 24 (position 41603789)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40142983
GRCz11 24 40030830
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACTGTTAATGGTTTAGCTGTACCTCAGGGAGAACCGCTCTTTCAGAAT[G/T]GTACAGTAATATTTATTTTCAGTTTTAGCTTTATATAATGTAATGCTTTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17228
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 360 4661 8 94
ENSDART00000136590 Nonsense 360 899 9 19
Genomic Location (Zv9):
Chromosome 24 (position 41605781)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40144975
GRCz11 24 40032822
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGTGTCTCAGTACGCTGCCAGCTTTGGAAACTCATGGCGCGTACAAGAT[C/T]AACAACAAAGCCAGGTGAWATGCTGCTTTTAGATACACATGGCKAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16303
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Essential Splice Site 459 4661 10 94
ENSDART00000136590 Essential Splice Site 459 899 11 19
Genomic Location (Zv9):
Chromosome 24 (position 41607324)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40146518
GRCz11 24 40034365
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGCTCAACAACACAKCATTATCAGCTGGAGGAGAAGAGGATTTTGTGG[T/A]RCTGTTGACTTTTTCTTAAACTAACAGTARCATGCTTTTGACTTRTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13835
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Splice Site, Nonsense 758 4661 15 94
ENSDART00000136590 Splice Site, Nonsense 758 899 16 19
Genomic Location (Zv9):
Chromosome 24 (position 41613271)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40152465
GRCz11 24 40040312
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAGACAGCTGGCAGAGAGAGTGTGTTCAGTCATYCACAGCAATGTCTTT[C/T]AGGTCAGTCTGATGAYGGCACGGCTATTATAGCAAWTTTACATTTTAACNT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44197
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 1520 4661 28 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41638945)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40178139
GRCz11 24 40065986
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGCTGTTTCTGCACCGCTGTGATGGTCACGATGACTGCGGAGATTA[C/A]AGTGATGAGCGAGGGTGTGTGTGTGCTCTCGGAGAGCTCCAGTGTCCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30152
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Essential Splice Site 2426 4661 43 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41668518)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40207444
GRCz11 24 40095291
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGACGGGCATGAAGACTGTCCTGACGGATCAGATGAACTTCACTGTGG[T/A]AAAAAAAATAAAATAGCTCATCTATTTTGATTATTATATCCATTCAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37962
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 2694 4661 49 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41671824)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40210750
GRCz11 24 40098597
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCTTTATCCAATCATAAACAGTGTGTGTAAAGATGGGCGTGTCCTATG[T/A]GATGAGTCCAGCTGTGTCGCTCGATGTGATTGGTCGGCCTGGTCTTCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24566
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 2710 4661 49 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41671871)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40210797
GRCz11 24 40098644
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTGATGAGTCCAGCTGTGTCGCTCGATGTGATTGGTCGGCCTGGTCTT[C/A]GTGGACATCATGTGACAGCAGCTGCGGGACAGGAGTACAGCACCGCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37963
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 3409 4661 65 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41692080)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40231006
GRCz11 24 40118853
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCGTGGTCAGAGTGTGACGCATGCGCGGGTGTCTCAGTCAGACAGAGG[C/T]AGTGTCACAGTCCTCCAGCGCGCTTTGGAGGTCTGCCCTGCATGGGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24567
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 3677 4661 71 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41700539)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40239465
GRCz11 24 40127312
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTGCAGGAATGTCCGTGTGTGGTGGACTCTGACCTCTTGACCTCTCTA[C/T]AAAGTGTGTTGGAGACCCCTGATGTGACCTTTGACATCCACAACATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1281
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Essential Splice Site 3797 4661 73 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41701109)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40240035
GRCz11 24 40127882
KASP Assay ID:
554-1196.1 (used for ordering genotyping assays)
KASP Sequence:
CTTTANNNNATTTACAGGTGTAACAGTTCCAACGGAGGAGCCATCTTTACCAGG[T/C]AATGATTGGATGTTTATTCATTCATTCATTCATTAATTCATTCATTCATT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa45840
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 4146 4661 82 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41707900)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40246826
GRCz11 24 40134673
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGTGTGAAGTTTGGCAAAAACTCAATATTTTGTGTGTTTCAGCACCTG[T/A]ATCCCTGAAGGAGAATACTGCCAGGATATTGACTGTCAAGGTGTGTACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3255
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Essential Splice Site 4217 4661 83 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41709042)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40247968
GRCz11 24 40135815
KASP Assay ID:
554-2648.1 (used for ordering genotyping assays)
KASP Sequence:
ACAGGACCTGAAAGAGACACCCGGGACTGCCATTCTGGACCCTGCCTGGG[T/C]ACTGATACTAAGCAMAAACACATCAACATCCATTCATWCACTCATTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24568
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Essential Splice Site 4217 4661 84 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41710970)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40249896
GRCz11 24 40137743
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGCTAATAATTCTGAATGTATTGCTGACCTGGTGACCTCTGTGTCCTCC[A/T]GATGACCTCTGCCCCTGGTCGACCTGGTCACGGTGTTCAGTCAGCTGTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5090
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 4252 4661 84 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41711078)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40250004
GRCz11 24 40137851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGATGTCCAGACGCAGACAGWGTGWATGTGATGAAGACGAGCAGGACTG[T/A]CCATCAGACGTCCAGAGAGATGAAGAGCAGACRCAGATGTGCTATAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8859
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 4306 4661 85 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41712906)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40251832
GRCz11 24 40139679
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACAGTTTGAGCTGCGRGTTCGAGTGCCRCTGGTTTTGTCCACCGGGGGG[C/T]AACGCTGYACTGATGTGGAGAAAMAGAGTCGACCCTGCAGACCCCAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37964
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Essential Splice Site 4324 4661 85 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41712964)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40251890
GRCz11 24 40139737
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTGATGTGGAGAAACAGAGTCGACCCTGCAGACCCCAAAACTGCAAAG[G/A]TGAACATCAACACACACACACACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30153
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Splice Site, Nonsense 4412 4661 88 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41714781)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40253707
GRCz11 24 40141554
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATTATCATTTCTATATTTGTAAACCTCATTATCCTGTGTGTGTTTCAG[T/A]CTCTGTCATGACGGCTCTCTGCAGTGTGATCTACGGGAATGTGAAGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37965
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 4466 4661 91 94
ENSDART00000136590 None None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41715325)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40254251
GRCz11 24 40142098
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTATGTGTGTGTGTTTAGATGTGTGTGACTGGAGCTCGTGGAGCAGAT[G/A]GAGTGTGTGTAAAGAGCCCTGCAGTGGAGGATTCAGACACAGAGAGAGAC
Associated Phenotype:
Not determined