Busch Lab

ZMP

ppapdc1a

Ensembl ID:
ENSDARG00000067798
ZFIN ID:
ZDB-GENE-081107-53
Description:
Novel protein similar to vertebrate phosphatidic acid phosphatase type 2 domain containing 1 family
Human Orthologue:
PPAPDC1A
Human Description:
phosphatidic acid phosphatase type 2 domain containing 1A [Source:HGNC Symbol;Acc:23531]
Mouse Orthologue:
Ppapdc1a
Mouse Description:
phosphatidic acid phosphatase type 2 domain containing 1A Gene [Source:MGI Symbol;Acc:MGI:2685936]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa38916 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44781 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38916
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097656 Essential Splice Site 136 263 4 6
ENSDART00000132111 Essential Splice Site 63 190 2 4
Genomic Location (Zv9):
Chromosome 13 (position 2672835)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2494403
GRCz11 13 2627581
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACCTGGTGTCTGAGGGCCGCAAGAGTTTTCCTAGCAGTCATTCGTCCT[G/T]TAAGTACTCAGTGTGTTACCAATTTTGTCTGTCTTATTTTTATTAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44781
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097656 Nonsense 207 263 6 6
ENSDART00000132111 Nonsense 134 190 4 4
Genomic Location (Zv9):
Chromosome 13 (position 2635474)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2531764
GRCz11 13 2664942
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCTCACAGATGCTTTTGTCGGGGGAGTGATCGGCCTGTTCTTCGCCTA[C/A]ATCTGTTATCGGCAGCACTACCCGCCGTTCCTGCACATAGACTGCCACCT
Associated Phenotype:
Not determined