Busch Lab

ZMP

si:dkey-20h16.3

Ensembl ID:
ENSDARG00000067730
ZFIN ID:
ZDB-GENE-081030-19
Description:
Novel protein similar to H.sapiens transient receptor potential cation channel, subfamily C [Source:
Human Orthologue:
TRPC6
Human Description:
transient receptor potential cation channel, subfamily C, member 6 [Source:HGNC Symbol;Acc:12338]
Mouse Orthologue:
Trpc6
Mouse Description:
transient receptor potential cation channel, subfamily C, member 6 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa5914 Nonsense Mutation detected in F1 DNA Not yet available
sa43162 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa5914
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097547 Nonsense 329 840 3 11
ENSDART00000136471 Nonsense 312 697 3 8
ENSDART00000146926 None None 64 None 2
Genomic Location (Zv9):
Chromosome 18 (position 40178346)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41788117
GRCz11 18 41778309
KASP Assay ID:
554-3740.1 (used for ordering genotyping assays)
KASP Sequence:
TGTATCTCTGCCTGCTTCCCACACAGTTTGTAGCCCATCCAAACTGCCAA[C/T]AGCAGCTTTTGTCCATATGGTATGAGAATCTGTCTGGGCTCAGGCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43162
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097547 Essential Splice Site 677 840 7 11
ENSDART00000136471 Essential Splice Site 660 697 7 8
ENSDART00000146926 None None 64 None 2
Genomic Location (Zv9):
Chromosome 18 (position 40200618)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41810389
GRCz11 18 41800581
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTCAACATGCTCATCGCTATGATCAACAACTCATTTCAGGAAATTGAG[G/A]TAATCACATTCTGAAATGAGATCTGTAAAACGACCAGACATTTGGATTGT
Associated Phenotype:
Not determined