Busch Lab

ZMP

hspb3

Ensembl ID:
ENSDARG00000067714
ZFIN ID:
ZDB-GENE-070705-338
Description:
heat shock protein, alpha-crystallin-related, b3 [Source:RefSeq peptide;Acc:NP_001092922]
Human Orthologue:
HSPB3
Human Description:
heat shock 27kDa protein 3 [Source:HGNC Symbol;Acc:5248]
Mouse Orthologue:
Hspb3
Mouse Description:
heat shock protein 3 Gene [Source:MGI Symbol;Acc:MGI:1928479]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10813 Nonsense Available for shipment Available now
sa18815 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10813
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097526 Nonsense 35 150 1 1
ENSDART00000097526 Nonsense 35 150 1 1
Genomic Location (Zv9):
Chromosome 5 (position 41922031)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39696748
GRCz11 5 40296901
KASP Assay ID:
2259-6302.1 (used for ordering genotyping assays)
KASP Sequence:
ACCAACAGCTCTTTAAAACAAGAAATCTCCAAGAAAGCACTGAAGATCAT[C/T]GACTCTTTGCCCTGCCAGGACCTGAATGTCTGCCTGTTAAAGTGGACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18815
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097526 Nonsense 35 150 1 1
ENSDART00000097526 Nonsense 35 150 1 1
Genomic Location (Zv9):
Chromosome 5 (position 41922031)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39696748
GRCz11 5 40296901
KASP Assay ID:
2259-6302.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAACAGCTCTTTAAAACAAGAAATCTCCAAGAAAGCACTGAAGATCAT[C/T]GACTCTTTGCCCTGCCAGGACCTGAATGTCTGCCTGTTAAAGTGGACACT
Associated Phenotype:
Not determined