Busch Lab

ZMP

LOC100332353

Ensembl ID:
ENSDARG00000067691
Human Orthologue:
MRPS30
Human Description:
mitochondrial ribosomal protein S30 [Source:HGNC Symbol;Acc:8769]
Mouse Orthologue:
Mrps30
Mouse Description:
mitochondrial ribosomal protein S30 Gene [Source:MGI Symbol;Acc:MGI:1926237]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29174
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097496 Nonsense 37 274 1 3
Genomic Location (Zv9):
Chromosome 19 (position 13735702)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 52357309
GRCz11 5 53003902
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTGTAACCGAAATGTCCAGGCTAAAGCTTCCACAGTAAAGGAATTATA[T/A]CCGCCCATTCTGCCGTCCTCGACCGCGAAGAGCACATCGGCCAAGAGGCG
Associated Phenotype:
Not determined