Busch Lab

ZMP

card9

Ensembl ID:
ENSDARG00000067672
ZFIN ID:
ZDB-GENE-060531-94
Description:
caspase recruitment domain-containing protein 9 [Source:RefSeq peptide;Acc:NP_001103755]
Human Orthologue:
CARD9
Human Description:
caspase recruitment domain family, member 9 [Source:HGNC Symbol;Acc:16391]
Mouse Orthologue:
Card9
Mouse Description:
caspase recruitment domain family, member 9 Gene [Source:MGI Symbol;Acc:MGI:2685628]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11441 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11441
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097471 Nonsense 39 534 1 12
Genomic Location (Zv9):
Chromosome 5 (position 52852066)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50519262
GRCz11 5 51165855
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACCGAATGCTTCTCATCAAGACCATTGAGCCCTCAAGGATAACACCTTA[T/A]CTGAGACAGTGCAAGGTGCTGAGCAGCGAGGATGAGGAGCAGATCTACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3567
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097471 Essential Splice Site 372 534 6 12
Genomic Location (Zv9):
Chromosome 5 (position 52846144)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50513340
GRCz11 5 51159933
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAGACATTCTGAAACAGCTGGAAGAGGTGATCAAAGAAAGAGACAAGG[T/C]ATAAACCCTYATCAGAGCAATACAATACAGTCATGTTCTGTATAGTTTAA
Associated Phenotype:
Not determined