Busch Lab

ZMP

ENSDARG00000067562

Ensembl ID:
ENSDARG00000067562
Human Orthologue:
CLTC
Human Description:
clathrin, heavy chain (Hc) [Source:HGNC Symbol;Acc:2092]
Mouse Orthologue:
Cltc
Mouse Description:
clathrin, heavy polypeptide (Hc) Gene [Source:MGI Symbol;Acc:MGI:2388633]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa34276 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34276
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097247 Nonsense 273 380 5 8
Genomic Location (Zv9):
Chromosome 8 (position 2273994)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2027205
GRCz11 8 2085748
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCATGGCGTGATCTACCTCATCACTAAATACGGCTACTTTCACATGTA[T/A]GATCTGGAGTCTGGAGTGTGTATTTACATGAACCGCATCAGCGCTGAGAC
Associated Phenotype:
Not determined