Busch Lab

ZMP

A5WUZ9_DANRE

Ensembl ID:
ENSDARG00000067549
Description:
Novel protein similar to vertebrate ADAM metallopeptidase with thrombospondin type 1 motif, 7 (ADAMT
Human Orthologue:
ADAMTS12
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 12 [Source:HGNC Symbol;Acc:14605]
Mouse Orthologue:
Adamts12
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12 Gene

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa31415 Essential Splice Site Available for shipment Available now
sa15083 Essential Splice Site Available for shipment Available now
sa25290 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10586 Essential Splice Site Available for shipment Available now
sa1731 Nonsense Available for shipment Available now
sa40362 Nonsense Mutation detected in F1 DNA Not yet available
sa33532 Nonsense Available for shipment Available now
sa20346 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31415
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Essential Splice Site 43 1499 2 26
Genomic Location (Zv9):
Chromosome 5 (position 9303942)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8405830
GRCz11 5 8910468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACGTCAAGAGCTCTGAACCGGACTACCTCTTTCCAGACACAGAGCAAG[G/A]TTTGTATCTTCATGCAAAACTATCATACAGCATGTGTTTAGGCTGTTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3543
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Nonsense 94 1499 3 26
Genomic Location (Zv9):
Chromosome 5 (position 9301080)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8402968
GRCz11 5 8907606
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGCGGCGTCAGAAGAGAGACCTGAATTCAGCAGAGAGGCGAGTGTATTA[C/A]AAACTCAACTACAGAGGTCGAGAGCTGACTCTTAATCTGACCACCAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15083
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Essential Splice Site 543 1499 11 26
Genomic Location (Zv9):
Chromosome 5 (position 9268115)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8370003
GRCz11 5 8874641
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCTAAACKAGACTCACCGATYGACGGAACCAGGTGTGGACCTGAAAAG[G/A]TAGGAGAGATACACAATYARAAAGAAGCACATAGTATTTGTTCTGTTMTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25290
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Essential Splice Site 543 1499 11 26
Genomic Location (Zv9):
Chromosome 5 (position 9268114)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8370002
GRCz11 5 8874640
KASP Assay ID:
554-7440.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTAAACTAGACTCACCGATCGACGGAACCAGGTGTGGACCTGAAAAGG[T/A]AGGAGAGATACACAATTAGAAAGAAGCACATAGTATTTGTTCTGTTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10586
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Essential Splice Site 649 1499 13 26
Genomic Location (Zv9):
Chromosome 5 (position 9264315)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8366203
GRCz11 5 8870841
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGCCGTATCACAATGAACTCTACCAGTGGATTCCTGTTTCAAGCCCTTG[T/A]AAGATCWCTTTGCATCAATATTCATTCATTCATTNNNNNNNNNNNNNNNNCATYNNNNTTATTTCGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1731
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Nonsense 797 1499 16 26
Genomic Location (Zv9):
Chromosome 5 (position 9254807)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8356695
GRCz11 5 8861333
KASP Assay ID:
554-1676.1 (used for ordering genotyping assays)
KASP Sequence:
GGAATGGAGAGTAYGAGGCTGGTGGCACAAAGTTTAACTACGAGCGCAGC[G/T]GAAATATAGAGAATCTCACCTCAGCGGGACCAACAACTGAACYTGTCATG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40362
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Nonsense 911 1499 19 26
Genomic Location (Zv9):
Chromosome 5 (position 9248205)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8350093
GRCz11 5 8854731
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGATCTGTATGAACTCTGTACTGACCTCAGGTGGTGGGTTGGAGGATG[G/A]CAGACGTGCTCGTCCACATGCGGTTCAACCGGAGTGAAAAAGCGCACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33532
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Nonsense 946 1499 19 26
Genomic Location (Zv9):
Chromosome 5 (position 9248100)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8349988
GRCz11 5 8854626
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTCCGTACGGTGGCTGGAGAAGAGCGAGTTCTGCACCCTGGTGACTG[T/A]AAGCAGCTGCTCAAACCCAAACCTGCAGTTCCTTGTAACCGAGACGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20346
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Nonsense 995 1499 20 26
Genomic Location (Zv9):
Chromosome 5 (position 9247786)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8349674
GRCz11 5 8854312
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCTTGTGATGGAGGAATAAAGTCGCGAATGGTCAAGTGTGTGGCAAAA[C/T]AACCCAGCCGGTGCAACCCTGCCACTCGACCCCGCTCCACAATCCTCTGT
Associated Phenotype:
Not determined