Busch Lab

ZMP

fgf10b

Ensembl ID:
ENSDARG00000067548
ZFIN ID:
ZDB-GENE-060828-1
Description:
fibroblast growth factor 10b [Source:RefSeq peptide;Acc:NP_001039323]
Human Orthologue:
FGF10
Human Description:
fibroblast growth factor 10 [Source:HGNC Symbol;Acc:3666]
Mouse Orthologue:
Fgf10
Mouse Description:
fibroblast growth factor 10 Gene [Source:MGI Symbol;Acc:MGI:1099809]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa20345 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20345
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097220 Essential Splice Site 125 187 3 3
Genomic Location (Zv9):
Chromosome 5 (position 9163111)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8265416
GRCz11 5 8770054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGTATGAGCTGGCACAGAAGCAAATGTAACACTCTTTTTATGCATTTC[A/G]GAGAAACTACGGCACAAATTGCCGCCTGAAGGAGCGCATCGAGGAGAACG
Associated Phenotype:
Not determined