Busch Lab

ZMP

adam19b

Ensembl ID:
ENSDARG00000067545
ZFIN ID:
ZDB-GENE-070705-541
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WW95]
Human Orthologue:
ADAM19
Human Description:
ADAM metallopeptidase domain 19 [Source:HGNC Symbol;Acc:197]
Mouse Orthologue:
Adam19
Mouse Description:
a disintegrin and metallopeptidase domain 19 (meltrin beta) Gene [Source:MGI Symbol;Acc:MGI:105377]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa30976 Nonsense Mutation detected in F1 DNA Not yet available
sa42343 Nonsense Mutation detected in F1 DNA Not yet available
sa38979 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30976
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097214 Nonsense 114 870 4 21
ENSDART00000132913 None None 131 None 4
ENSDART00000143179 None None 186 None 4
ENSDART00000097214 Nonsense 114 870 4 21
ENSDART00000132913 None None 131 None 4
ENSDART00000143179 None None 186 None 4

The following transcripts of ENSDARG00000067545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 6537906)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6265293
GRCz11 14 6572020
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGCGTGTCTGTGTTTTTCATAGGGAGCTGTTCTCCTCGGAATAT[C/T]AAGAAATATGGTACGATACAAATGGAAATCGGCAGTTTTCCAGACCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42343
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097214 Nonsense 114 870 4 21
ENSDART00000132913 None None 131 None 4
ENSDART00000143179 None None 186 None 4
ENSDART00000097214 Nonsense 114 870 4 21
ENSDART00000132913 None None 131 None 4
ENSDART00000143179 None None 186 None 4

The following transcripts of ENSDARG00000067545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 6537906)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6265293
GRCz11 14 6572020
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGCGTGTCTGTGTTTTTCATAGGGAGCTGTTCTCCTCGGAATAT[C/T]AAGAAATATGGTACGATACAAATGGAAATCGGCAGTTTTCCAGACCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38979
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097214 Nonsense 731 870 19 21
ENSDART00000132913 None None 131 None 4
ENSDART00000143179 None None 186 None 4

The following transcripts of ENSDARG00000067545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 6568593)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6295980
GRCz11 14 6602707
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTTTTTGACTGATGTTTTTGTCTTATCTTATGTGCAGGCAGCTTTTA[T/A]CTTGTGCTGGTTCTCCTCAGCTTGTCTTTTCTTCTGGCGTTGGCTGTGCT
Associated Phenotype:
Not determined