Busch Lab

ZMP

si:ch211-87l8.1

Ensembl ID:
ENSDARG00000067509
ZFIN ID:
ZDB-GENE-081031-75
Description:
Novel protein similar to vertebrate solute carrier family 24 (Sodium/potassium/calcium exchanger), m
Human Orthologue:
SLC24A4
Human Description:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 [Source:HGNC Symbol;Acc:1097
Mouse Orthologue:
Slc24a4
Mouse Description:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 Gene [Source:MGI Symbol;Acc:

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37169 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10429 Essential Splice Site Available for shipment Available now
sa37170 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37169
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031139 Essential Splice Site 213 636 5 17
ENSDART00000145132 Essential Splice Site 80 165 3 7
ENSDART00000148149 None None 203 None 5
Genomic Location (Zv9):
Chromosome 20 (position 50475792)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50360533
GRCz11 20 50163537
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTATGGCTGCGGGAAGCTCAGCGCCCGAACTCTTCGCTTCGGTTATAGG[T/A]AAATGCGTCCCTCAGTCACAATCATTTTGCACAAAGAAACAATCCCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10429
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031139 Essential Splice Site 272 636 7 17
ENSDART00000145132 Essential Splice Site 139 165 5 7
ENSDART00000148149 None None 203 None 5
Genomic Location (Zv9):
Chromosome 20 (position 50477906)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50362647
GRCz11 20 50165651
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTCCGTGACTYTTTCTTCTACATATTGTCTGTAGTCGCCCTGATTGTG[G/A]TGAGTCTTAAATMAAACACGCTAACAYCTYTCTGTAATGAGTTTCCCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37170
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031139 Essential Splice Site 490 636 14 17
ENSDART00000145132 None None 165 None 7
ENSDART00000148149 Essential Splice Site 57 203 2 5
Genomic Location (Zv9):
Chromosome 20 (position 50501077)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50385818
GRCz11 20 50188822
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTATATCAACATACAGATGACACTTGACCAGTTTCCATTACTTCTTCC[A/G]GGTGACAATTATTGGATATACGCTGGGCATTCCTGATGTCATCATGGGTA
Associated Phenotype:
Not determined