Busch Lab

ZMP

zgc:174623

Ensembl ID:
ENSDARG00000067501
ZFIN ID:
ZDB-GENE-080219-5
Description:
Zgc:174623 protein [Source:UniProtKB/TrEMBL;Acc:A9JRR1]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa33095 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33095
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106541 Nonsense 251 276 2 2
Genomic Location (Zv9):
Chromosome 3 (position 8544287)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCTGAAAAGACACGAGAGGATTCACACCGGAGAGAAACCTTACAAGTG[T/A]TCACACTGCGACAAGAGATTCATACAGTTGGAAAGCCTGAAAAGACATAA
Long Flanking Sequence:
CAGTGTGGGATGAGTTTCAGACAATCATCAAACCTTAATAATCACATGCTGATCCACACTGGAGAGAAAACACACAAATGTGATCAGTGCGGCAAAACATTTTTCAGGGCTTCAGATCTGAAGAGCCACTTTAGAGTTCATACAGAGGAGAAGCCTTATTCATGCTCTTTGTGTGGAAAGAGTTTCAGACATCGAGAAAGTTTAAGAATTCATGAGAAGATCCACACCGGTGTGAGAGAGTACAAGTGCTCTGAGTGTGAGAAGACCTTTTATAGCGATGAACACTTGAAACTACATGAGAGAACTCACACTGGAGAGAAACCGTACATTTGTTCAGTGTGCATTAGGAGTTTCAGTCATTTTGAACATCTGAAAATACATGTGAGGATTCACACTGGAGAGAAACCGTACAAGTGTTCACACTGCGACAAGAGATTCAGACAGTTAGTAGTCCTGAAAAGACACGAGAGGATTCACACCGGAGAGAAACCTTACAAGTG[T/A]TCACACTGCGACAAGAGATTCATACAGTTGGAAAGCCTGAAAAGACATAAGAGGATTCACACTGGAGAGAAGCCTTAAAGGGGGGGTCCACAGCGTTTTTTTTTTAAGGTTTAATTGTGTTTAGAATCAGAATCAGTTTTATTGCTAAGTGTGCTTCACACACACCAGGAATGTGTTTTGGCTACAGAAGCTTCCAGTGCACATAAAGTGACACTACAAAATAAATACGAAAAAAAGTTGATAAACATTAAACAGAGATGCAGTTAGTCGAGAAATCTGGATGTTGGATTGTATGTACAGATTTGTTATAAATACACAGGTTATACGGTGCTCCGTACAAATGCGAATGGAGAAAGTATTGTGTTGTATATTGATATAAGGTGCTGTGTACAAGTAAGTATGAGAAAGTAGTGCACATGTTTATTGCCAGTTGGGGGATATTTAACTGTTCATGAGGTAGATGGCCTGAGGAAAGAAACTTTCCCTGTGTCTGGCTGTTT
Associated Phenotype:
Not determined