Busch Lab

ZMP

vps72

Ensembl ID:
ENSDARG00000063718
ZFIN ID:
ZDB-GENE-060503-88
Description:
transcription factor-like 1 [Source:RefSeq peptide;Acc:NP_001076413]
Human Orthologue:
VPS72
Human Description:
vacuolar protein sorting 72 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:11644]
Mouse Orthologue:
Vps72
Mouse Description:
vacuolar protein sorting 72 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1202305]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa29110 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18361 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29110
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093383 Essential Splice Site 90 369 2 6
Genomic Location (Zv9):
Chromosome 19 (position 378005)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 367936
GRCz11 19 368143
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGGACGCACCGAAGAGGAAGAGCCGTGTCGTCACCAAAGCATACAAGG[T/G]CACAAATCACACAGAGAGAGAGAGTGTGTGTGCGCGTGTGCGTGTGTGTG
Long Flanking Sequence:
TTAGATGAGCTCCAGGTTTGGCTTCAGCACTGACTAATCTAATGTATATGCACAGATATAATACTGCAGAGCTTCCTATTAAGCATATGAATATACAAGAGAGATTTGTGAGGGGTGCACTTATATATGCTGAGCACTGCAGATATATTTACCTCAACAATATTTCTCGACAGACGTTTTCCTTTAAACTCTTTTCATTTACATTCAAGCATTAAAGTCAAATTGCATTAGTAAATGTAGACGTTAACAGTAAATAAGCTGAATGTTTTTCCTGATATCAGCTGATGTCTGGTGTCTTTTCTAATATAAAATGTGTGCTGTGGTGTTTGCCGTGGCGATTCTGCAGGAGTCTGGAGATGATGAGTACCACGGCGATCACTCAGACACAGAGGACGAGGTGGACAGCGACTTCGACATCGATGAAGGAGATGAACCTGATAGTGGACAGGAGGAGGACGCACCGAAGAGGAAGAGCCGTGTCGTCACCAAAGCATACAAGG[T/G]CACAAATCACACAGAGAGAGAGAGTGTGTGTGCGCGTGTGCGTGTGTGTGTGTGTGTGCGTGTGTGTGTGCGTGTGTATGCAAGCTCATATATATGTGTGTGTGTGTGTGTGTTCAGGAGCCGCTGAAGGTCTCCAAGCCCAAAGTGAAGCGAGTGTCTGAAGAATTAAAGCCGGAACGACCCAGAGTTGAGCGGCGCACCGTTCGGGACGAGCTGCAGGATTTAGGAGACAGTGAGACACACACACTACATTTAACCGATTTCACATGTGAAAGTAGTTTTAATTTTAATTGTAGTTTCTTTTGTTGTTATTTTGATGTGTATAATATGTTTGTAGTTCTTGTTAAAGGTCCTCTGAAATGATAGCGTTGTACATGTTAGTCTTCAGGATATCTTTAATCTAGTGTCTCCAAAACAGTGACCCAGTTCACATTTAGCGGATATAAACCTGATATATAAACATCTACAGGTGGAATCAATTATTTTTCTGTTGTCGTCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19209
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093383 Nonsense 176 369 4 6
Genomic Location (Zv9):
Chromosome 19 (position 379003)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 368934
GRCz11 19 369141
KASP Assay ID:
2261-2701.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAAAGGAGCGCAGAGCGAACGCGTGCTGACGCAGGACGAGCTGCTGGAT[G/T]AAGCAAAACTCACCGCCGAGAGCAACCTGCGCTCACTGGGTAACTGCACA
Long Flanking Sequence:
CTCATACTTGAGTCACTCATCAAATCTGCTGACCAATCAAATGCTCTCTAGTGTCTGACATGCCCCGCCCACTACTTTTCATGCTGTTCATTTGATCCACCACTCTCACTGGCAGAGCTGAAAAAATCTAACACTATTGGCTGATATTTAAAAAAGGGAGGAGCTATATTATGCCCCGCCCTCTAACGTCTCGCATCAATAAAATAAAATGCTCATTTCAAAGCAGTGCACGGGACCTTTAATAAACATTTTCTTTAATTTATGACATAAATTGTTTCATGAAAAGGCACAGCTCAAACAATCGGGTGTTTTCTGAATGTAAAACAAAAGTAAACCTGTAGTGCTGTTGCTGTCTTTCAGTCCGTAAGTCGGTGCGCAAGTCGACGAGTGAACACACGCGCAAGACAAACGAGCGTCTGCAAGAGCGCCAGCAGGAGGCGCCGCGCAAGAGGAAAGGAGCGCAGAGCGAACGCGTGCTGACGCAGGACGAGCTGCTGGAT[G/T]AAGCAAAACTCACCGCCGAGAGCAACCTGCGCTCACTGGGTAACTGCACACCTCCACACCACACTACCTGACAAAAGTCTACGTTTTAGGAACACAGATAATATCTGCTCTTCTAGTTGCTGATCTGGTGTCTGAAGTGTCTCTATGAAAGGTGAAGGCCTCTAGATTTTGCTGATTTGAGCTCAGTAAATCTGATCATGTCTTGATGTTGACTGATTTGATGAGGACAGTGCGCTCTGACTCTGCTCAGACTAAAGTCTCATCACTGAACAGAAATAATGTCCAGTATAGAATATAAAGTCCTGCTGCAGTGGAGACAGAATGAAGATTGTGTCTGACTCCATCATGAGCTTGGAGGACTGCATCCATACATCTCTGACATGACTCACATCACTGATTAATAAAGTCATCTGGAATGAAGAAGAAAGCTTCAGCAGAGTTCATCAAGAGTCTTTGTGTTCATCTTCAACACCTCCTCCTTCATCAGCTCAATAATGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18361
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093383 Nonsense 324 369 6 6
Genomic Location (Zv9):
Chromosome 19 (position 381287)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 371218
GRCz11 19 371425
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACATCCCATACGCAAACGCCAGAGCCTTCAGGATCATCAGAGAAGCYTA[T/A]CAGAAATACATCGCCGCTCACGGATTCCCCAATGCTTCCGGAAGCTTCAG
Long Flanking Sequence:
AACACACACACACACACACACACACACACACTTCAACACACAGATTAACACAACACTACTGTAAACACACACACATTAATAAAACACTATTATTGCAGTGGTATATCATATATTAATTTGTGTTAATAATATAATTTCTTTGCTCTCCATCTAATATTAATGTTTGAGTCAGTATATAATAATAACAGCAGTTTATTGTGAATGAAACACCATTGATCGACTCCGCCCTCTTCTTGTAGGCTGGACCAGGACACACCCCAGGCCACACCCACCTCGTCATCCTCCACACAGGGGGCGGGGTCTCTGTGCTCACGGACTTACATCACTTTCAGTGATGATGAGGCGTTTAGCTCCGCCTTCCCGTCGGCGGCTCGCTGTACCCCCACACACCCAGTGCAGGAGGTGTGTCCTGTGACCCATAAACCCGCCCTGTACCGCGACCCCGTGACCGACATCCCATACGCAAACGCCAGAGCCTTCAGGATCATCAGAGAAGCTTA[T/A]CAGAAATACATCGCCGCTCACGGATTCCCCAATGCTTCCGGAAGCTTCAGCGCTAACACCGACGCTAGCGATTCACCTGCTAATTTGAAGAGCGCACGACCCAAAGCTGTGCTCAAGCAGAGCGCCGCCGCCACTTAAAGACACCGTTCACCCAAAAATCTACATTTACACTGTTTACTCACTCTTCAAACCTTTATGAGCTTTATTGAAGAATGCTGGAAACCGGTAACCATTAACTTCCATTGTAGGAGTAACAAATGGATGTGAATAGGTACAGGTTTTCAGCATTCTTCAAAATATCTTTCTTTTTGTTTTACATAAGAAAGAAAGTCATAGTTATTAATTATAAAATTAATACATAAAATTATTATTATTATTATTATTATTATCATTAGTAGTAGTAGTACTATCATCCTCATCATGAAGGTTTAAGGGGAGTAAATGATGAGAGATTTGTTATTTTTTGGGTGAACTGTCTCTTTAAACAGCACAATGGTTTT
Associated Phenotype:
Not determined