Busch Lab

ZMP

si:dkeyp-24a7.8

Ensembl ID:
ENSDARG00000063713
ZFIN ID:
ZDB-GENE-060503-370
Description:
Novel protein similar to vertebrate DAB2 interacting protein (DAB2IP) [Source:UniProtKB/TrEMBL;Acc:Q
Human Orthologue:
SYNGAP1
Human Description:
synaptic Ras GTPase activating protein 1 [Source:HGNC Symbol;Acc:11497]
Mouse Orthologue:
Syngap1
Mouse Description:
synaptic Ras GTPase activating protein 1 homolog (rat) Gene [Source:MGI Symbol;Acc:MGI:3039785]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa36741 Nonsense Available for shipment Available now
sa15234 Nonsense Available for shipment Available now
sa10044 Nonsense Available for shipment Available now
sa32224 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36741
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093368 Nonsense 280 1311 8 21
ENSDART00000137880 Nonsense 259 1260 7 18
Genomic Location (Zv9):
Chromosome 19 (position 269789)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 259720
GRCz11 19 259927
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACCGAAGAAGCGCTACTACTGCGAGCTGTGTCTGGACGACATGCTGTA[C/A]GCTCGAACCACCAGCAAACCGCGCACCGACACCGTCTTCTGGGGCGAACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4773
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093368 Essential Splice Site 323 1311 8 21
ENSDART00000137880 Essential Splice Site 302 1260 7 18
Genomic Location (Zv9):
Chromosome 19 (position 269919)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 259850
GRCz11 19 260057
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAGCCTCCGACTGCACCTCTACAAGGAGAACGACAAGAAGAGGAGGAAG[G/A]TAGCTCTGCTYGYGCGCAAGTGTACACGCTGCCTCCCGAAYGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15234
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093368 Nonsense 617 1311 13 21
ENSDART00000137880 Nonsense 596 1260 12 18
Genomic Location (Zv9):
Chromosome 19 (position 275240)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 265171
GRCz11 19 265378
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGTGTGTGTGTNNGCGCGTGCTCTGGGCAGGTTCAGYGGGAAGGAGGACTA[T/A]CTGGGCTTCATGAATGAGTTTCTGGAGATGGAGTGGGGCTCCATGCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10044
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093368 Nonsense 1084 1311 17 21
ENSDART00000137880 Nonsense 1063 1260 16 18
Genomic Location (Zv9):
Chromosome 19 (position 278428)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 268359
GRCz11 19 268566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACAGAGMSGCAACCTCCTCCAATCGCCTGARTCTAGTTTTGGAGGGAGG[C/T]AGTTGACAAGGCAGCAGCTGTCAGTCAAGGACAGCCCCGCCCCCGGGTTK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32224
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093368 Nonsense 1234 1311 19 21
ENSDART00000137880 Nonsense 1213 1260 18 18
Genomic Location (Zv9):
Chromosome 19 (position 280630)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 270561
GRCz11 19 270768
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGAAGGAGCGTCTGATGATGTCCCACCGTAAGCTGGAGGAGTACGAG[C/T]GACGGCTACACTCGCAGGAGCAGCAGACCAGCAAGATTCTGCTGCAGTAC
Associated Phenotype:
Not determined