Busch Lab

ZMP

FARP1 (2 of 2)

Ensembl ID:
ENSDARG00000063695
Description:
FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) [Source:HGNC Symbol;Acc:
Human Orthologue:
FARP1
Human Description:
FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Farp1
Mouse Description:
FERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived) Gene [Source:MGI Symbol;

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa44699 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44699
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093306 Nonsense 36 314 2 11
Genomic Location (Zv9):
Chromosome 9 (position 1179652)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1188806
GRCz11 9 988164
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCGTGACGTTGTTCTCATCTCTGCTGTTGCTTTACTTTACAGGTCTG[G/A]CTGGATTTACTAAAGCCCATTAGAAAGCAGATCACACGTAAGACCACTCT
Associated Phenotype:
Not determined