Busch Lab

ZMP

si:dkey-263h23.7

Ensembl ID:
ENSDARG00000063682
ZFIN ID:
ZDB-GENE-060503-633
Description:
Novel protein similar to vertebrate formin homology 2 domain containing 3 (FHOD3) [Source:UniProtKB/
Human Orthologue:
FHOD3
Human Description:
formin homology 2 domain containing 3 [Source:HGNC Symbol;Acc:26178]
Mouse Orthologue:
Fhod3
Mouse Description:
formin homology 2 domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1925847]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa23403 Nonsense Available for shipment Available now
sa9923 Nonsense Available for shipment Available now
sa25077 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23403
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093281 Nonsense 303 1407 9 25
ENSDART00000146050 Nonsense 309 1323 9 24
Genomic Location (Zv9):
Chromosome 19 (position 719466)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 740953
GRCz11 19 740762
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGTGGATGTTCTTGAGGAGCAGGGCATGGAGAGCGTTTCTCAGCGGTA[T/G]CTGGGCCGCAAGGGCACCGATCTGGACCTGCTGGAGCAGCTCAACATATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29115
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093281 Essential Splice Site 321 1407 None 25
ENSDART00000146050 Essential Splice Site 327 1323 None 24
Genomic Location (Zv9):
Chromosome 19 (position 719522)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 741009
GRCz11 19 740818
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGCAAGGGCACCGATCTGGACCTGCTGGAGCAGCTCAACATATATGAGG[T/G]CTGACCATCTCAATCAGTGACTCCTTCATGTGGGTTTGGACTAATTGACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4775
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093281 Essential Splice Site 472 1407 13 25
ENSDART00000146050 None None 1323 None 24
Genomic Location (Zv9):
Chromosome 19 (position 727585)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 749072
GRCz11 19 748881
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGAGACTATGTGTCCAACATGGAGGAGGCCAGACATGCTCGAGAGGAGAG[G/A]TGAGATTTCCTCCTTTATTAATGCATCATTTATTGTTTATATATACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9923
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093281 Nonsense 1085 1407 20 25
ENSDART00000146050 Nonsense 1001 1323 19 24
Genomic Location (Zv9):
Chromosome 19 (position 740242)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 761729
GRCz11 19 761538
KASP Assay ID:
2261-2726.1 (used for ordering genotyping assays)
KASP Sequence:
AAGTGTAGCTGATGCTGGTGTGTGCAGGCYAAGGGCTTCGATCTGAACTA[T/A]CTGGAGAAGGTTCCGGAGGTGAAGGACACGGTGCACAAACAGTCTCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25077
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093281 Nonsense 1205 1407 22 25
ENSDART00000146050 Nonsense 1121 1323 21 24
Genomic Location (Zv9):
Chromosome 19 (position 740817)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 762304
GRCz11 19 762113
KASP Assay ID:
554-7514.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGTGTTGATTGATGTTTCAGGTTCCACTCGTTCCTGCTGTTCCTGGGT[C/T]AGCCGGCGTACAGCGTGCGGGAGATCAGCGTGACGCGCTTCAGTAAGATC
Associated Phenotype:
Not determined