Busch Lab

ZMP

wtip

Ensembl ID:
ENSDARG00000063666
ZFIN ID:
ZDB-GENE-050419-261
Description:
Wilms tumor protein 1-interacting protein homolog [Source:UniProtKB/Swiss-Prot;Acc:A8DZE6]
Human Orthologue:
WTIP
Human Description:
Wilms tumor 1 interacting protein [Source:HGNC Symbol;Acc:20964]
Mouse Orthologue:
Wtip
Mouse Description:
WT1-interacting protein Gene [Source:MGI Symbol;Acc:MGI:2141920]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35608 Nonsense Available for shipment Available now
sa45502 Nonsense Mutation detected in F1 DNA Not yet available
sa22391 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35608
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093239 Nonsense 393 648 1 8
Genomic Location (Zv9):
Chromosome 13 (position 52090604)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 604212
GRCz11 18 493430
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCAGAAGTCAACATTGGGTTTAACTACTGCAAGGCGGGCGCCGGGGGA[C/T]AGCGCTTCAAGCTGCCGTACCAGGTCACTCCATCTCGGGACAGCGGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45502
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093239 Nonsense 480 648 3 8
Genomic Location (Zv9):
Chromosome 13 (position 52053249)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 566857
GRCz11 18 456075
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCTGTGTTTGTTTTTTCAGGACGGAGGCTACGAGGAAAGGCTTTCTA[T/A]AATGTTAATGGAAAAGTGTACTGTGAAGAAGACTTCCTGGTGAGTATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22391
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093239 Nonsense 523 648 5 8
Genomic Location (Zv9):
Chromosome 13 (position 52041033)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 554641
GRCz11 18 443859
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTGTGTGTTGTAGATCCTGCAGGCTCTGGGCAGGTCGTA[T/A]CACCCTGGTTGTTTCCGCTGTGTGATCTGCAAGGAGGGTCTGGACGGAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa831
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093239 Nonsense 595 648 7 8
Genomic Location (Zv9):
Chromosome 13 (position 52039437)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 553045
GRCz11 18 442263
KASP Assay ID:
554-0734.1 (used for ordering genotyping assays)
KASP Sequence:
GAGACCAYACGGGTGGTGTCTATGGATAAAGATTACCATGTAGATTGCTA[T/A]CACTGTGAGGTAAGACACACTTCATCATATTACACTCAACTACTGGCTAA
Associated Phenotype:
Not determined