Busch Lab

ZMP

lnpa

Ensembl ID:
ENSDARG00000063646
ZFIN ID:
ZDB-GENE-030131-4960
Description:
Protein lunapark-A [Source:UniProtKB/Swiss-Prot;Acc:Q7ZU80]
Human Orthologue:
KIAA1715
Human Description:
KIAA1715 [Source:HGNC Symbol;Acc:21610]
Mouse Orthologue:
Lnp
Mouse Description:
limb and neural patterns Gene [Source:MGI Symbol;Acc:MGI:1918115]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34544 Nonsense Mutation detected in F1 DNA Not yet available
sa27320 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34544
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093187 Nonsense 18 393 2 17
Genomic Location (Zv9):
Chromosome 9 (position 2018220)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2026463
GRCz11 9 2027260
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAACACTTGTGTGTCCATTTCCAGGCTAAACCATCCACTGTAGAGGTCT[T/A]GGAGGGTCTTGATAAGGTAAAAATACTTATCTAATGATTTTCTGCTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27320
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093187 Essential Splice Site 288 393 15 17
Genomic Location (Zv9):
Chromosome 9 (position 2032569)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2040812
GRCz11 9 2041609
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTGTCTCATAACGGCATGGCTTTAAAGGAGGAGTTTGAATATATCGG[T/C]GAGATCTTTATCAGTACAGCAGATATTTACATTTATAAGCACAACACAAT
Associated Phenotype:
Not determined