Busch Lab

ZMP

si:ch211-133n4.10

Ensembl ID:
ENSDARG00000063613
ZFIN ID:
ZDB-GENE-070424-123
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0R0P0]
Human Orthologue:
ENDOD1
Human Description:
endonuclease domain containing 1 [Source:HGNC Symbol;Acc:29129]
Mouse Orthologue:
Endod1
Mouse Description:
endonuclease domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919196]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa12604 Nonsense Available for shipment Available now
sa25081 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12604
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105152 Nonsense 119 290 4 5
ENSDART00000135698 Nonsense 114 276 2 2
Genomic Location (Zv9):
Chromosome 19 (position 3848325)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3344898
GRCz11 19 3285796
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATCTTYGTCTGTTGTGCAGCTKGAAACYTCWGGTGTTCARATGCGTGCA[C/T]GACRTGTTAATCAGGCGTATACAGAAGACTACCAGMAATTGTATAGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25081
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105152 Nonsense 250 290 4 5
ENSDART00000135698 Nonsense 245 276 2 2
Genomic Location (Zv9):
Chromosome 19 (position 3847932)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3344505
GRCz11 19 3285403
KASP Assay ID:
554-7296.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCCCGAGCTCACTGGGCTGCAAACAAAGACGAGAGTGAAGATAAGAAG[A/T]AGAAAATCCCTGAAAAAACACTGAAGGAATTACTGCAGTTTCTGGAGGAG
Associated Phenotype:
Not determined