Busch Lab

ZMP

antxr1

Ensembl ID:
ENSDARG00000063612
ZFIN ID:
ZDB-GENE-090514-5
Human Orthologue:
ANTXR1
Human Description:
anthrax toxin receptor 1 [Source:HGNC Symbol;Acc:21014]
Mouse Orthologue:
Antxr1
Mouse Description:
anthrax toxin receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1916788]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35178 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35179 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27855
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093113 Nonsense 270 552 11 18
Genomic Location (Zv9):
Chromosome 12 (position 3297368)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2684368
GRCz11 12 2719101
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGCACATTCATATGTTTCTGTGTGCAGATGAGAAGCCGGCGAGTGTT[G/T]AAGACACGTTCCTGCTGTGTCCTGCGCCTGTTATAGATGAAGTCGGAAAG
Long Flanking Sequence:
CCAATTATTTTTATTTACATAATTTGAGTTCAGAAACTGCAGAGATGTTAAAATGATCGTACCGATATAATAATAATGATGACTGAAATGGGAAACCATATTTGTGAAATTCAATAGGTGGCGATAATGCTAAAAAGTTACCATAGATGGTTTGCCTAAATCGTGTGTCCTAGATTGTGTGTGCCTAAAACGTGTGTGGTTCTGCGGGGCTGCAGCTGGATATTATTGGGGATAAGTTGGCGGTTCATTCCCCTGTGGCAACCCCTGATTAATAAGGGACTAAGTCAAAGGAAAATGAACGAATGAAGGATTCAAATTGTGTCACTTGGGAAATATCTGAAAAATAATTACACAGGAGGGCGAATCATTTTGTAGCCCTGATGAGGAATGTGTACTTCAAAAACTCCAATTATTCCAAACATGAGTGTATAATCTGCCTTTCTGATGTATTTCTGCACATTCATATGTTTCTGTGTGCAGATGAGAAGCCGGCGAGTGTT[G/T]AAGACACGTTCCTGCTGTGTCCTGCGCCTGTTATAGATGAAGTCGGAAAGTAAGCTTGCGTCTGCCATGCATTAGAGCCGTGTTTATGATCCCAGTCAAAGGTCACATTCCCCTTCCTGCACAACACACTGGTTTACTTCTGAGGTCATGCTGTTCAGCCACGCTTCTCCAGCAAGTTCCTCGTTTTCTGTTTCCTTTCGGCAGAATCAATGTATGATGTCAGGCTGTCTGAGGAGTCTTTATAGCAGACACTTCCTCTGAAATCATGCACACACACCCACACACACTTGTTTTTCTTTGTTCCTCATCCATTATTTCCCTCTGGCCATTTATTGCTCTCAAAGACACTGGAGGTTGCATATTTTCTTCCCATCAGAAACTGCGTCTATTTATCACTAAGGAGTGCATCTGACAGTCTCGCACTGCTACATGAACTGACTGTTTTGAGGATTGCATAGGCTGGACAACAACGCCTGTAATGAAAAGGAAGGGAATCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35178
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093113 Essential Splice Site 286 552 11 18
Genomic Location (Zv9):
Chromosome 12 (position 3297418)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2684418
GRCz11 12 2719151
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGACACGTTCCTGCTGTGTCCTGCGCCTGTTATAGATGAAGTCGGAAA[G/A]TAAGCTTGCGTCTGCCATGCATTAGAGCCGTGTTTATGATCCCAGTCAAA
Long Flanking Sequence:
AAATGATCGTACCGATATAATAATAATGATGACTGAAATGGGAAACCATATTTGTGAAATTCAATAGGTGGCGATAATGCTAAAAAGTTACCATAGATGGTTTGCCTAAATCGTGTGTCCTAGATTGTGTGTGCCTAAAACGTGTGTGGTTCTGCGGGGCTGCAGCTGGATATTATTGGGGATAAGTTGGCGGTTCATTCCCCTGTGGCAACCCCTGATTAATAAGGGACTAAGTCAAAGGAAAATGAACGAATGAAGGATTCAAATTGTGTCACTTGGGAAATATCTGAAAAATAATTACACAGGAGGGCGAATCATTTTGTAGCCCTGATGAGGAATGTGTACTTCAAAAACTCCAATTATTCCAAACATGAGTGTATAATCTGCCTTTCTGATGTATTTCTGCACATTCATATGTTTCTGTGTGCAGATGAGAAGCCGGCGAGTGTTGAAGACACGTTCCTGCTGTGTCCTGCGCCTGTTATAGATGAAGTCGGAAA[G/A]TAAGCTTGCGTCTGCCATGCATTAGAGCCGTGTTTATGATCCCAGTCAAAGGTCACATTCCCCTTCCTGCACAACACACTGGTTTACTTCTGAGGTCATGCTGTTCAGCCACGCTTCTCCAGCAAGTTCCTCGTTTTCTGTTTCCTTTCGGCAGAATCAATGTATGATGTCAGGCTGTCTGAGGAGTCTTTATAGCAGACACTTCCTCTGAAATCATGCACACACACCCACACACACTTGTTTTTCTTTGTTCCTCATCCATTATTTCCCTCTGGCCATTTATTGCTCTCAAAGACACTGGAGGTTGCATATTTTCTTCCCATCAGAAACTGCGTCTATTTATCACTAAGGAGTGCATCTGACAGTCTCGCACTGCTACATGAACTGACTGTTTTGAGGATTGCATAGGCTGGACAACAACGCCTGTAATGAAAAGGAAGGGAATCCATCGTGCTGTTTTTATATTTATTTTAGGTTTCATGCCTAAATAAAATGAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35179
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093113 Essential Splice Site 473 552 17 18
Genomic Location (Zv9):
Chromosome 12 (position 3306474)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2693474
GRCz11 12 2728207
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCGTGGATATGATCAGGTTTCACTCATGAGGCCGCAGCCAGGAGATCAT[G/T]TGAGTATTTGGTTCTAGATTATTCCATTTTAGGGGGGGGGCACTGTGGCT
Long Flanking Sequence:
GAGATTACTCAAAAAAAGAGAAACAAATCTGTAATTGCTGGTAAAACGGATGCAGTGCAGTTATTAGAGAATATACAATTAATAAATTATAATAACGTAGGCAGATTTCATGTTTCAAAAAAGTGTGTGAAATGATGTGTTGTTTTTGCTGTGTGCAGGTTCGCTGGGGAGGCAAAGGCTCCACCGAGGAGGGAGCGAAGCTGGAGAAACCCAAAAACGCCGTCATAAAGATGCCGGAGCAGGAGTTTGAACCCTTTGAACCCAAGCCCAGAAAATCAGACCACAGGAAGCCGACTCAGAACAGGAAGTGGTACTCGCCCATCAGGGTAAAGACGCTTCATCACCGTCGCTACTGTTTATTGATGTTGGTTGCGAGCTTAATTGAGTCCAGTGTTTAACAGCACGTTCCTCCTGTTCAGGGTAAACTGGATGCCATCTTGGCTCTTTTCCGCCGTGGATATGATCAGGTTTCACTCATGAGGCCGCAGCCAGGAGATCAT[G/T]TGAGTATTTGGTTCTAGATTATTCCATTTTAGGGGGGGGGCACTGTGGCTCAGTGGTTAGCACAGCAAGAAGGTTGCTGGTTCGAGTGCCAGCTGGACCAGTTGGCATTTCTGTGTGGAGTTTGCACGTTTCCTCCGGGTGCTCCGGTTTCCCCCACAGTCCAAACACATGCGCTATAGGGAATTGGAGAAACTAGATTGGCCGTAGTGTATGAGTGTAAATACAAGTGGGTATGGGTGTTTCCCAGTACTGGATTGCAGCTGAAAGGGCATCTGATGCGTAAAACAAATGCTGGAATAGTTGGCGGTTCATTCCACAGTGGCGACCTCTGAAATAGAAAAGCTTGTTTATCCAGATTTGACCAATCAGATGAGACTTTGCTTTCTTTAGTCTCCTATTGGCTATTGGCTAGAGCAGCACAAAAGTGAATCTAGAACCTCAAAGCAGAGAGCTGAAAATAAATACTAATACCAGGACCAGAAACAAGTGAGGGAAATGAC
Associated Phenotype:
Not determined