Busch Lab

ZMP

NRXN2 (1 of 4)

Ensembl ID:
ENSDARG00000063606
Description:
neurexin 2 [Source:HGNC Symbol;Acc:8009]
Human Orthologue:
NRXN2
Human Description:
neurexin 2 [Source:HGNC Symbol;Acc:8009]
Mouse Orthologue:
Nrxn2
Mouse Description:
neurexin II Gene [Source:MGI Symbol;Acc:MGI:1096362]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa40816 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40816
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131050 Nonsense 385 536 6 7
Genomic Location (Zv9):
Chromosome 7 (position 484822)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 541662
GRCz11 7 494613
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGCTTCATGTCCCAGCGGGCGTACGGCCTCCTCATGGCCACCACATCC[A/T]AAGAGTCTGCAGACACCCTGCGCCTGGAGCTGGACGGAGGACGGGTCAAG
Associated Phenotype:
Not determined