Busch Lab

ZMP

coro2bb

Ensembl ID:
ENSDARG00000063604
ZFIN ID:
ZDB-GENE-071009-5
Human Orthologues:
CORO2A, CORO2B
Human Descriptions:
coronin, actin binding protein, 2A [Source:HGNC Symbol;Acc:2255]
coronin, actin binding protein, 2B [Source:HGNC Symbol;Acc:2256]
Mouse Orthologues:
Coro2a, Coro2b
Mouse Descriptions:
coronin, actin binding protein 2A Gene [Source:MGI Symbol;Acc:MGI:1345966]
coronin, actin binding protein, 2B Gene [Source:MGI Symbol;Acc:MGI:2444283]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3309
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093093 Nonsense 394 470 10 13
Genomic Location (Zv9):
Chromosome 25 (position 1190802)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1143073
GRCz11 25 1223718
KASP Assay ID:
554-3116.1 (used for ordering genotyping assays)
KASP Sequence:
TGTGTGTGTNNNNNNNNNNNNNNNNACAGGGCCAGTGCTGATTTCTCTTAAAGAAGCGTACAAA[C/T]GACCAAATCCAGTCAGTCTGAGAGCGTCCAGACGGGACAGACGGATGAYA
Associated Phenotype:
Not determined