Busch Lab

ZMP

DGKI

Ensembl ID:
ENSDARG00000063578
Description:
diacylglycerol kinase, iota [Source:HGNC Symbol;Acc:2855]
Human Orthologue:
DGKI
Human Description:
diacylglycerol kinase, iota [Source:HGNC Symbol;Acc:2855]
Mouse Orthologue:
Dgki
Mouse Description:
diacylglycerol kinase, iota Gene [Source:MGI Symbol;Acc:MGI:2443430]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9623 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26205
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093005 Nonsense 355 968 12 33
Genomic Location (Zv9):
Chromosome 4 (position 4514731)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4632680
GRCz11 4 4641583
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGCATGAGTAGCAAATGTCTCTATTGTCTCCATCTGTCCATCAGGTTG[G/T]AGTTGTACAGGAAAGTGCCAAATCTTCGCATCCTGGCCTGTGGAGGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9623
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093005 Essential Splice Site 373 968 12 33
Genomic Location (Zv9):
Chromosome 4 (position 4514674)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4632623
GRCz11 4 4641526
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGGAAAGTGCCAAATCTTCGCATCCTGGCCTGTGGAGGAGATGGAACC[G/A]TAAGACGCAGTGCATGATGGGAAAAYTTTTGTCTATATTGAAATGAATCT
Associated Phenotype:
Not determined