Busch Lab

ZMP

si:ch211-146l10.2

Ensembl ID:
ENSDARG00000063573
ZFIN ID:
ZDB-GENE-030131-6671
Human Orthologue:
VPS41
Human Description:
vacuolar protein sorting 41 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:12713]
Mouse Orthologue:
Vps41
Mouse Description:
vacuolar protein sorting 41 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1929215]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa30047 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44094 Nonsense Mutation detected in F1 DNA Not yet available
sa24448 Nonsense Available for shipment Available now
sa18279 Essential Splice Site Available for shipment Available now
sa24447 Essential Splice Site Available for shipment Available now
sa37829 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30048
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092975 Essential Splice Site 151 854 8 29
ENSDART00000143390 Essential Splice Site 151 855 8 29
ENSDART00000145845 Essential Splice Site 132 736 6 24
Genomic Location (Zv9):
Chromosome 24 (position 9730361)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9789245
GRCz11 24 9929631
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATACCGGTGAATGTCTTTCATCACTGATATTATTGGAATATTCTTCATA[G/A]CTTTTGCTGTATGAGAGGAACTGGCTGAACCGCTGGAAGACTTCAGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30047
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092975 Essential Splice Site 190 854 8 29
ENSDART00000143390 Essential Splice Site 190 855 8 29
ENSDART00000145845 Essential Splice Site 171 736 6 24
Genomic Location (Zv9):
Chromosome 24 (position 9730239)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9789123
GRCz11 24 9929509
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCAGTGTGAAATGGAGAGGAAATCTTATCGCCTGGGCAAACAATGTGG[T/A]ACGGACAGATTAAAATATGATAATCATGATGCGTTTCTCACAGGACATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44094
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092975 Nonsense 258 854 10 29
ENSDART00000143390 Nonsense 258 855 10 29
ENSDART00000145845 Nonsense 239 736 8 24
Genomic Location (Zv9):
Chromosome 24 (position 9728228)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9787112
GRCz11 24 9927498
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGTTAAAGAGCGTGACCCAACAGAGATGAGGGATCTACCCAGTCGCTA[T/A]GTTGAGATCGGTATTGCTATGTTCACTACTGAATCTCTTATAAAAGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24448
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092975 Nonsense 370 854 13 29
ENSDART00000143390 Nonsense 370 855 13 29
ENSDART00000145845 Nonsense 351 736 11 24
Genomic Location (Zv9):
Chromosome 24 (position 9722666)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9781550
GRCz11 24 9921936
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCGTAGTGGCTAAAGAAAGAGACCAGGATGACCACATTGACTGGCTTT[T/A]GGAGAAGAAGAAATATGAGGTACATGTCTAAGCAGTATGTATTGTTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18279
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092975 Essential Splice Site 395 854 None 29
ENSDART00000143390 Essential Splice Site 396 855 None 29
ENSDART00000145845 Essential Splice Site 377 736 None 24
Genomic Location (Zv9):
Chromosome 24 (position 9720508)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9779392
GRCz11 24 9919778
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGGCAGCAGAGATCAGCTTTAAAAATATTAAAAGGCATGATGTACAGG[T/A]AAAATCAAATGGCAAATGTGGATTAWTGAAGTGYGGAAGAATNNNNNNNNTATTACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24447
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092975 Essential Splice Site 517 854 19 29
ENSDART00000143390 Essential Splice Site 518 855 19 29
ENSDART00000145845 Essential Splice Site 499 736 17 24
Genomic Location (Zv9):
Chromosome 24 (position 9714311)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9773195
GRCz11 24 9913581
KASP Assay ID:
2261-8453.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATATAGACCCCCCACCCACTTGCTAATATGTATGTGTTTGTTATGTAT[A/G]GATACACATATGATCAACGTTATGATCGAGCTCTGGAAATCTACCTGAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30046
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092975 Nonsense 714 854 25 29
ENSDART00000143390 Nonsense 715 855 25 29
ENSDART00000145845 Nonsense 696 736 23 24
Genomic Location (Zv9):
Chromosome 24 (position 9706883)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9765767
GRCz11 24 9906153
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATATTTCTCTTTTTATTTTCTGTACTGTAGCTTTTATCACAGGCCTCT[T/A]GAATAACATTGGAACCCATGTGGACCCAATCCTGCTCATTCATCGCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37829
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092975 None None 854 None 29
ENSDART00000143390 None None 855 None 29
ENSDART00000145845 Essential Splice Site None 736 23 24
Genomic Location (Zv9):
Chromosome 24 (position 9706699)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9765583
GRCz11 24 9905969
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTAAAACAGCATGATTTTTTGGCCGCATTTAATGTCAATGTCAATGGCA[C/T]TATTATGGCCCATTTCTACTGAGTGGTACGGTATGCTTTGGTTCAGTACC
Associated Phenotype:
Not determined