Busch Lab

ZMP

COL4A3BP (1 of 2)

Ensembl ID:
ENSDARG00000063542
Description:
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein [Source:HGNC Symbol;Acc:2205]
Human Orthologue:
COL4A3BP
Human Description:
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein [Source:HGNC Symbol;Acc:2205]
Mouse Orthologue:
Col4a3bp
Mouse Description:
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37202 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37202
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013851 Nonsense 12 483 1 13
ENSDART00000108553 Nonsense 12 510 1 14
Genomic Location (Zv9):
Chromosome 21 (position 2332774)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2539961
GRCz11 21 2565785
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTGTCTCTATGTTAAAGGCTGAATCTGGTTATGGATCTGAATCCAGTT[T/A]GAGGAGACACGGCTCCATGCTGTCCCTCACATCTGCCACCAGCGGATACT
Long Flanking Sequence:
GGACTTCTAGCGCGAGTTTGGTGCTCAAGTCTGCATCAGTGCGTCCTCGATATCAAGATCACATCCTGGAAGTTTCATGCGTCCTCTGTACTTGCGGTCTTGAGTATTGGAACTGCACTTATGTAGCCGATGATGACGTAACACGAGGTCGCAAGACCGCTGAAGAACGCATATTGAGAAACAGCCATTGTATAACACTGGTTTGTTCTGGAGACAATCCAAAACTAATATTGCTGAAGGGGACTAATAATATTTACCTTAAAATGCATTGAAAATAATTAAAAACTGCTTTTATTCTCGCTGAAATAAAACAGACTCTCTCCAGACGAGAAAATATTATAGGAAATACTGTGAAAAATTCCTGAATCTGTTCAAGATCATTTGGGAAATACTTGAAAAGGAAGAAAACATTCATCTGTCAGACTTGGGCTGTGTTTCGCTAATCTCTCTCTTTGTCTCTATGTTAAAGGCTGAATCTGGTTATGGATCTGAATCCAGTT[T/A]GAGGAGACACGGCTCCATGCTGTCCCTCACATCTGCCACCAGCGGATACTCAGCCACCTCCACATCCTCCTTTAAGGTGAAAACACACACACTTACAACATCAATCAGTGCTAATAATAAAAACACCACTGCTTTATAAGTCGATAAACTAGTCTGAACTCAAACAACACTGTACACTAGCTGACAGAAGTCTTGTCGCCTATCCAAGTTTTAGGAACAGCAAATAATAACTTGACTTCTAGTTGATCATTTGGTATCAGAAGGGGCTTATATGAGAGGTAAAGGCCTCTAGATGACGCTTATTTGAGCACAATAAAATATAATCATGCCTTGATTTTGACTGATTTAATTAGGACAGTAAGGTCTGACTTTGCCTAGACTAAAGTCTTGTGACTGAACAGAAATAATGTCCAGTATAGAATATAAAGTCCTGCTGCAGTGGAGACAGAATGAATATTGTGTCCGACTCCATCATGAGCTTGGAGGACTGCATCCACACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7945
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013851 Nonsense 367 483 11 13
ENSDART00000108553 Nonsense 394 510 12 14
Genomic Location (Zv9):
Chromosome 21 (position 2356124)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2516611
GRCz11 21 2542435
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NNTGTGTGTGTTCAGAGAGTGTGGCCGGCGTCCCAGAGAGATGTCTTATA[T/G]CTGTCTGCCAWCCGCAAGATTATGGCCAATAATGAGAACGACCCAGACAC
Long Flanking Sequence:
TACTCACACTATGTACAGTTGCCTTGAACCGGGCCGAAGCACGCTTGTCCCCCCCAACACCAACTGCCAACTGACCCAAACCAGCTGCCTTCTTGCTGTGGGGCCACAGTGCTAACCATTGAGCTACTGTGTCGCCGGTCTAATATTCAGTTCAAGTTTACTTGTATAGCGCTTTTCACAATAATAATGGTCCCAAAGCAGCTTCACAAAAGGCGCACATCATTACATTCCAGTCCAAATCAGAAAGGTTAAAGAGCTGTGTAAAGGCTTGGCCGTATCTAAACGTAATCTTCATCTGTGTCTGCAGCTACTGTAGAAAACTTCAACATTGTGGAGACGTTGTCCGATAACGCCATCATCATCTACCAGACTCATAAGGTGAGGAGAGCGAATAAGTTTACACTGCTGTGTGTAATGCGTCCCCTCATGATCATTTCCCTGACGGACTGTTGTGTGTGTGTTCAGAGAGTGTGGCCGGCGTCCCAGAGAGATGTCTTATA[T/G]CTGTCTGCCATCCGCAAGATTATGGCCAATAATGAGAACGACCCAGACACGTGGCTCGTCTGCAACTTCTCCGTCGAACACGACAACGCCCAGGTGAGTCTGGTCTCCATGGTGACCGCTGCATTTGTGCCGTCTGTTTTGTTTTTTTTAAATATATTTTTATTGAACATTTTTTTGTGCAAAAACAGGTCAGAAAATTATATTGAGTGTAAAGATAACAGAAGTTTACATACACTGTATAAAAGGCACATAACCATTTAAAAAAGGTCAGATGTTAATGTGACTAAACTTTTCCTCTTTTAGGTAAGTTAGGATGATCAAATGTGTTTCTGTTCTGCTTAATAGCAGAATAATGAGAGAGATTTTGTTTGAGAAATTGTTATAACTTTTCTTAAAAGTCAAGTTTACAGACAATAAGATTATTCTGCCTGTGAAAGAGCTCAGATGATGATGTCAAGGTTTTGGAAGTTTCTGATTGGCTAATTGACAACATTTGAGTT
Associated Phenotype:
Not determined