Busch Lab

ZMP

si:ch211-51m24.3

Ensembl ID:
ENSDARG00000063535
ZFIN ID:
ZDB-GENE-041111-187
Description:
chromodomain helicase DNA binding protein 4 [Source:RefSeq peptide;Acc:NP_001038323]
Human Orthologue:
CHD4
Human Description:
chromodomain helicase DNA binding protein 4 [Source:HGNC Symbol;Acc:1919]
Mouse Orthologue:
Chd4
Mouse Description:
chromodomain helicase DNA binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1344380]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa23422 Essential Splice Site Available for shipment Available now
sa23421 Nonsense Available for shipment Available now
sa39225 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23420 Nonsense Available for shipment Available now
sa44902 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa3029 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4066
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005453 Essential Splice Site 342 1930 7 40
ENSDART00000092923 Essential Splice Site 342 1929 8 40
ENSDART00000130062 Essential Splice Site 342 1929 8 41
Genomic Location (Zv9):
Chromosome 19 (position 5666196)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5125507
GRCz11 19 5041993
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCAGTCGCAGCAGCGCYAAAAAGAAGCCCAAAAAGAAGACGAAAAAGGG[T/C]GAGGATCTCACTCTCTTTTCTGAATCTTGTGAACGTATTAGACAAACTGT
Long Flanking Sequence:
TTTCAGGTCCCAATGCACGCAAGAAGTCCAAACCAGCTCCTAAACCCCAGGAGAAGAAGGTCAAAACCAAAAAGGTGGCTCCCTTGAAGATCAAACTAGGAGGCTTCAACAGCAAGAGGAAACGCTCATCTGTAAGCCCCTCAGTTTTGCTTCATTATTCGTCCATCTTGCCTAATCACTCATGCTTTAAGAATTTCCACAAGCAATGTTTTTTTTTTTCTTCTTGGCTATGTGCTAATTTTAGACCTAGCGCCTTGCTAATGACGTTCAAGTAATTTTCCGGTCATTTTAGACTGAAGCAGAGAGCATTGCACCGTGATTCTGTTTTTCAGCATCGCTCATGTTGCGCATTCTGTTTTTCAGAGTGAAGAGGATGATGTTGATGTGGACAGTGACTTTGACGACGGCAGTATTAACAGCGTGTCTGTTTCAAATGGATCGAATAGTCGTAGCAGTCGCAGCAGCGCCAAAAAGAAGCCCAAAAAGAAGACGAAAAAGGG[T/C]GAGGATCTCACTCTCTTTTCTGAATCTTGTGAACGTATTAGACAAACTGTTGTCGAAAAAGCATCTTATTATTGTTATAAAAATTTTGAGAATGAGCAAATATGTTCTAGTTTTAGATTTTTGAGAACTGACTTGTACAAAAATTTGGCTCTTGAAAATGTTAAACATACTTGGAAAAGCCAAAATTTGTGTGAGATCTTCCACTAAATATTAATATACACTTGAGCTGTCATGAGTTACTAATAATTTCCATTTCAGTTTTTTTGGATTTAGTTCATTTGTGTTAGTTTTTAATGTCTAACTAATATAAATCATAGCAGTTGACAGTTTTAAATGATAAATCTGTTTCTTTTTACAATTAATTTGTTTCCGGAATGCGTTTTACACTTTAATGTGTCTGAATTAAAAATCTGTATTTTCTTGCCACAAATTAAAACAAAAAGGTCTCCTCATTTTAAAGGGCATCTACTTTACCCCTTTTACAAGATGGAAGATATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23422
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005453 Essential Splice Site 475 1930 9 40
ENSDART00000092923 Essential Splice Site 476 1929 10 40
ENSDART00000130062 Essential Splice Site 476 1929 10 41
Genomic Location (Zv9):
Chromosome 19 (position 5663238)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5122549
GRCz11 19 5039035
KASP Assay ID:
2261-2843.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCGCTGCCCGAGATCCCCAACGGAGAGTGGATCTGCCCTCGCTGCACTG[T/C]GAGTCAAACATGCTAGAGCTTAAAGGTCTGAGGTCAGACTGTTTTCAAGA
Long Flanking Sequence:
GAGACAGATCATCAGGATTACTGTGAGGTCTGCCAGCAGGGAGGTGAGATCATTCTCTGTGACACCTGTCCACGGGCCTATCACATGGTCTGCTTGGACCCCGACATGGAGAAGGCCCCTGAGGGTACCTGGAGCTGCCCACACTGCGTGAGTGAACCGGATGAATCTCAGATTGCACCGTTTGCCCTTTTGTTTTTGTCCAGCAAGCTTAATTAACATAGATGCCAGTAAAATTTAAGTGTTAAACCATCCCCTGCTTCTCCAGGAGAAGATGGGCATCCAGTGGGAGGCTCGTGAAGACGCGTCTGAGGGCGAGGAGGATAATGAGGCAGGAGGAGAGGCCGAAGAAGACGACCATCACATGGAGTTCTGCAGAGTCTGTAAGGATGGCGGAGAGCTGCTGTGCTGCGACTCATGCCCTTCGTCATACCACATCCACTGCCTGAACCCACCGCTGCCCGAGATCCCCAACGGAGAGTGGATCTGCCCTCGCTGCACTG[T/C]GAGTCAAACATGCTAGAGCTTAAAGGTCTGAGGTCAGACTGTTTTCAAGACGTTGATTTTATGACTTCGTAAATAGTTTGTAATAAATGTTAATATGAGAAATTATGTACATATATAAAATTTTGTTAATATGCATTTTTTTTTCAAATCTTAAAACTATAAATCTGATTGGGACTCAACATGCGTTGGTGTTAGGGATTTTAAATTAAGGACATGTATAATTGTTCTCTATCCTTTATATTTCCTTTATAAACTCCTGTATAACAGGCATGTCATTGGTAAATTGCACAGTAATTGTTGCATCTAATTGATTGTAAAAATATACATTTATAACAGATATGCAGTCTCATGTATGTATGTATATATGGACTATTCTTTTAAAATATATTCATTTAAATGGAACTTATATTTTTATATATTACTATGACATAAACATTATGTATAAACATTTTTTATTAATATAATTTATTATTTATATAAACATTCATTTTTATTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23421
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005453 Nonsense 632 1930 12 40
ENSDART00000092923 Nonsense 633 1929 13 40
ENSDART00000130062 Nonsense 633 1929 13 41
Genomic Location (Zv9):
Chromosome 19 (position 5659159)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5118470
GRCz11 19 5034956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATAAGAAGAACAACTGTCACTACCTCATCAAATGGAGGGACTTAACATA[T/A]GATCAAGCCACATGGGAGTTGGAGGATATGGATTTACCAGACTATGACAC
Long Flanking Sequence:
ATGTTTGCCTTAGAAGAGTCAAAAACTTACATACAGCACCTTTAATTAGATTAAGATTTAATCTACTATGTGCATCCAGAGAATTGTTAATTACTATTTGTCATTTTGGCAGAATTTGCACCTAGTTTGAGTTTTTACTTCTCTTGCTGTTTCCAGCTGGAGATTCACTGTCAGGTGATGTTCAGAAACTACCAGCGCAAGAACGACATGGACGAACCTCCCCCCATAGACTTCGGAGGTGAAGGAGAAGAGGAGAAGAGCGACAAGAGAAAGAAAAAAGACCCCACATACGCACGGATGGAGGAGAAGTACTACCGCTTCGGCATCAAGATGGAGTGGATGGTCATTCATCGAATCCTGAACCACAGGTCAGTTGAACTCCACATCTCTGGACTCATTTTCGATCAGTTACATGGATTTACGTGTGCCGTTTACTTTCTTTTTAGTGTGGATAAGAAGAACAACTGTCACTACCTCATCAAATGGAGGGACTTAACATA[T/A]GATCAAGCCACATGGGAGTTGGAGGATATGGATTTACCAGACTATGACACGTATAAACTGCAGTACTGGAACCACAGGTATATACATGTACATAGACATTAATATTGACAACACAAACAGAATGATTCAAGTAACTATCATCATCATCATCATCATTGTTATTATCTTGGTGGATAATGTAATTGTTTGTTTTAGTATTCGTTTTATTACTATTAAATTTATCTGTTATTGTTGAAATATTTAGAATTTGTCTTTTTTTTTCTCTGTTAGTTAAAGTTGTAGTTTTGTATAAGTAGTTTTTTTTTTCCATTTGTCTTTATTTTACTGCCGTTCACGTTTACTTTATTTTAGATTTTGTTTATTCACTGCTCTAGTTTTTATTCATACTTTATTTTTGCTTATAATATAATTTTTTTTAATTTTATTATTTTGTAATATTACATTTAGAAAAGCTTAAATGGTACTATTTGATTTCTATTTGTTTCTGTTTTAGTATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39225
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005453 Essential Splice Site 658 1930 12 40
ENSDART00000092923 Essential Splice Site 659 1929 13 40
ENSDART00000130062 Essential Splice Site 659 1929 13 41
Genomic Location (Zv9):
Chromosome 19 (position 5659080)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5118391
GRCz11 19 5034877
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGATTTACCAGACTATGACACGTATAAACTGCAGTACTGGAACCACAGG[T/C]ATATACATGTACATAGACATTAATATTGACAACACAAACAGAATGATTCA
Long Flanking Sequence:
AGAATTGTTAATTACTATTTGTCATTTTGGCAGAATTTGCACCTAGTTTGAGTTTTTACTTCTCTTGCTGTTTCCAGCTGGAGATTCACTGTCAGGTGATGTTCAGAAACTACCAGCGCAAGAACGACATGGACGAACCTCCCCCCATAGACTTCGGAGGTGAAGGAGAAGAGGAGAAGAGCGACAAGAGAAAGAAAAAAGACCCCACATACGCACGGATGGAGGAGAAGTACTACCGCTTCGGCATCAAGATGGAGTGGATGGTCATTCATCGAATCCTGAACCACAGGTCAGTTGAACTCCACATCTCTGGACTCATTTTCGATCAGTTACATGGATTTACGTGTGCCGTTTACTTTCTTTTTAGTGTGGATAAGAAGAACAACTGTCACTACCTCATCAAATGGAGGGACTTAACATATGATCAAGCCACATGGGAGTTGGAGGATATGGATTTACCAGACTATGACACGTATAAACTGCAGTACTGGAACCACAGG[T/C]ATATACATGTACATAGACATTAATATTGACAACACAAACAGAATGATTCAAGTAACTATCATCATCATCATCATCATTGTTATTATCTTGGTGGATAATGTAATTGTTTGTTTTAGTATTCGTTTTATTACTATTAAATTTATCTGTTATTGTTGAAATATTTAGAATTTGTCTTTTTTTTTCTCTGTTAGTTAAAGTTGTAGTTTTGTATAAGTAGTTTTTTTTTTCCATTTGTCTTTATTTTACTGCCGTTCACGTTTACTTTATTTTAGATTTTGTTTATTCACTGCTCTAGTTTTTATTCATACTTTATTTTTGCTTATAATATAATTTTTTTTAATTTTATTATTTTGTAATATTACATTTAGAAAAGCTTAAATGGTACTATTTGATTTCTATTTGTTTCTGTTTTAGTATATTTTGGGTCCATTTTATTAAACATTGATATTAATATTTCGAGTTGGCTTTTATTTTTGTAATTTTGGATTTCATTATAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23420
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005453 Nonsense 683 1930 13 40
ENSDART00000092923 Nonsense 684 1929 14 40
ENSDART00000130062 Nonsense 684 1929 14 41
Genomic Location (Zv9):
Chromosome 19 (position 5657328)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5116639
GRCz11 19 5033125
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAAACCAGGAAAGAAGATCAAGATCAAAGGGAAGATGCGCAAACTGGAC[C/T]GACCTCCAGAGAATCCTGTCGTGGATGTAAGCAAGCATTTTTCATTATGC
Long Flanking Sequence:
GTGCAACTAGATAACTAGAGTTGCGTAATATTTGTGTTCCTGCTGCAGCCATGGTACAGCAACAAAGTTCCTTGATTATTACGCATGAATAGAAGTATAGTTCCTAGCCATATCAACATGGCAACTTTTTATTTTCCATCGCTCTGGGTACACGATGTAACTTCAGAAGAGTCCAGCTTTAAATAGGAAAATTGTCTGATTGCTTTTATTAATTTAAGATGCCAATGGTCTAATCCGATTTAATGATCTATGCTAAGCTAAGGTAAAGGTGCTTACACTAGACCTGGAGATTGTCTCAATGGATTCAAATCCAATGAAATGTTAAAACTCAACTCAAACTTAACTCTAGGGGAATTGTGAAATGATACTTGGTGTTCCTTCAAGTGTGAGAAAATGCACATACATCTTCTGTTTCTCTTTCTTAAAGGGAGCTGATGATGGGTGATGAAGGTAAACCAGGAAAGAAGATCAAGATCAAAGGGAAGATGCGCAAACTGGAC[C/T]GACCTCCAGAGAATCCTGTCGTGGATGTAAGCAAGCATTTTTCATTATGCCATACACTATAATGACAACACATTCAACTCTTGTGTATTGTTCAGATTGACTACCCTTTCATTATGTTCGGGGTTGTATTTTACCCATTGACCTCCATTATAACCATGTTTTTGATTGCAAAGCCATGACACAGCCATGTATTAATATAATCATGAGTTCTTGATTGTTGGTGGTTTTCCTTGTTGGGAAGAGGTGGAATTTGTCAGTTTTACGGTTGATCATCAGTTGGGACCATTAACCCTTTAGATAGACCTGTGCAAATACGTTTCTGGCTATTCTGTGGGGTAAAAAATGTAGATTATAGTGTGTATTCATATATACACTTACTATGTTTACTATGATCTGAGAGCTGAGCTGCTTTTTTATTTTCTCAAACATATCAAGGTAATTGTGCAAAGTCTCTTACACGCGCACAGTATACTCCATATACAAGCCAGAAACTAAGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44902
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005453 Essential Splice Site 1217 1930 24 40
ENSDART00000092923 Essential Splice Site 1218 1929 25 40
ENSDART00000130062 Essential Splice Site 1218 1929 25 41
Genomic Location (Zv9):
Chromosome 19 (position 5648615)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5107926
GRCz11 19 5024412
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACATTCTTAAATTCGGTACAGAGGAGCTATTTAAGGACGAGGGAGAAGG[T/A]ATGACACAACATCTTAAATAAAGCTTCTCAGTGCAGCAAAGAAATGCTAT
Long Flanking Sequence:
AGTTCAACTAGGTTATAAGCAGCTCTACAGAAATACCACTGGAGTTCAGTAATATTACTCAATATGAAGTGTTTTTAACAAACTCAAAAGGTCACATTATTTATTTATTTAACATTTTTTGGTTTTGTTATAGCCATCTTCAATTTTCCTTGTGTTTCCTCTTTGTAGGCCTTCAGCAGAGCTCACAGGATTGGTCAAAACAAGAAGGTGATGATCTACCGCTTTGTAACCAAAGCTTCTGTAGAAGAGCGAATTACTCAGGTATAATCCACAGTCTTTGCAGGAAACTAAATAATATTATTCACCAACAGTGTCTTTTAAATCTAATCTGACCGGTTTATTTGCGTTTCTTATCTGAAGGTGGCCAAGAAGAAGATGATGTTGACTCACTTGGTTGTGCGTCCTGGATTGGGCTCAAAGACTGGTTCGATGTCTAAACAGGAGCTCGATGACATTCTTAAATTCGGTACAGAGGAGCTATTTAAGGACGAGGGAGAAGG[T/A]ATGACACAACATCTTAAATAAAGCTTCTCAGTGCAGCAAAGAAATGCTATATAGATATATAATGACTCTTTAAAACTACCCATTTTAGCCTTTGATCATAATTGGGGCGTTTTGGTGACTGTTGCTTTAAATTTAAATGAGACTGTGCTCATTTTAAAAGAGGGCGGAGCTACAAATGCCTGTGTTTCAGCATAGTGGCAGATTCAAAAACAAGACTTGCATCCTATGCTAATGAGGGAGAGATTGTCACCAATGGGTGGGGCCTCTCCATTCTGATGACGCGTACAAATGGAGAATGTCGATTTCGACGATTTTATCAAGTGTGCTTATAAACAATAAAATTAATACATTTTTTGCCATTGAAAGCTGGTTATATTCACAGACTGTTGCTACACAACTTTGTTTAAACCCTCCTTTTACACACTTTAAAATGTAAAAGTTTTTTTTTAATTTGCGATGTTGCTATAAACTCTTTATATGCTCTCTATTATACGTAATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa764
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005453 Essential Splice Site 1654 1930 33 40
ENSDART00000092923 Essential Splice Site 1648 1929 34 40
ENSDART00000130062 Essential Splice Site 1648 1929 34 41
Genomic Location (Zv9):
Chromosome 19 (position 5637774)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5097085
GRCz11 19 5013571
KASP Assay ID:
554-0670.1 (used for ordering genotyping assays)
KASP Sequence:
GACAAACCCAAAGGATCTGAGGCCGACAAGGAGACTTCAGACGCCAAAGG[T/C]GGACAGAAATGACAATTAACTTTTATAATGATTGTTTTTAATCTAGTTAA
Long Flanking Sequence:
CAACTGAGCCGAGGATCAAATCAGCAACCTTCTTGCTGTGAGGCAACAGCACTACCTGCTGCGCCACTGCTTCACCAAATAGTACCAAAAAAATCTAAATCAAGTAAGAATGAACACAAGTAATCAGTCGGTTGGTATTAACAATCACAGTGTTGTCTTATTTACTTGAACACTGGTCTGGATCTCTGCTTAATGTTTATTATTTTAACCTGATTTGTTTTAGATGATTTTGTCAATAATTGAGTTCTCGTTCTTCATTTAAAGGTCATTGCTGTTCCGGATGAAGATGGCCGAGCTGCTTCTGCGTCTGAGGAGAAAGAGAAAGGCAAAGAGGAGAAGGAGAAGACGCCTGAATCCTCCTCGGAGGCAGAAAAGGCTGATGGGAAGCAGGAAGAGAAGGAAGAAGAAAACGCCAAGTCGGGAGACTCTGAGGAGAAAACTGATGATACAGACAAACCCAAAGGATCTGAGGCCGACAAGGAGACTTCAGACGCCAAAGG[T/C]GGACAGAAATGACAATTAACTTTTATAATGATTGTTTTTAATCTAGTTAATAACTCCCCTATAGTTAAACGGTTGCGTTTAATCTATTCAGCCAATCTCCAGGTCTGGCAGGACAGCTTTTAGCTTAGCTTAGCATAATTAATCAAATCTGATTAGACCGTTAGCATCTATCTTTAAAATTTCGATAATTTTCTTTTGTCTTTTTCCTTTTTTTTCTTGTATGAAATGCCTGAGTTAGCCAAAAATGCTATTTTGCATCTTCAGATGCCAAACGTGGACAAAAATTACAATTAAGCTTTATAATAATTGTTTGTAATCTAATTAAAAACCCCCCTACAGTTAAACAGCTGCATTTTTCTCTATTTGTAATCTGTTCAGCAGATCTTCTGGTCTGGCAGGAACACTTTTAGTTTAGCTTAGCATAATTAATTGAATCTGATTAGACCATTAGCATTTCTCTTCAAAATTTTGATAATTTTCTTTACTTTTTTTTTTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3029
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005453 Nonsense 1910 1930 39 40
ENSDART00000092923 Nonsense 1909 1929 40 40
ENSDART00000130062 Nonsense 1909 1929 40 41
Genomic Location (Zv9):
Chromosome 19 (position 5627605)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5086916
GRCz11 19 5003402
KASP Assay ID:
554-3401.1 (used for ordering genotyping assays)
KASP Sequence:
CAACCATCGCCAGGATACCGCCTGTTGCAGTGAGGCTGCAGATGTCWGAA[A/T]GAAACATTCTCAGCCGTTTGGCCAGCAGAGGACCAGACACACMGAGTCAG
Long Flanking Sequence:
TACTGCCAGTAAAAGATCAATTAGTGTCAAATAAAATCTTCTTTATGATCAGGCAAATTATTTACGCTTATGTCCCTCTGCAAAAACCTTCAGAAAGTAAATATAAATAAAACGGTGTCAAATTTGGTGTATGTAAGTGTAGGTTTATTAACTTTTGAGTAAATGACCTTTGAATTACAGTTACAATACATATTTTAAGACACAAACTGATAAAGTGCCACAAAAGAAATACTTAAAGTAGTAATTAGAATGTTTTGTTTTTTTTACCAAAAATCTAAAAACGGAGTTTCATGAAGAAAACGCCTTTTAATTATATAGGAATCGATTATTGATGAGCTCTTGAGTTCTCGCAGACGACACTCAGTACTTTTATTCTTGTGTGTCCGACAGTACTGAAGCAGCTGGAGGAGTTGCTAAGTGACATGAAAGCCGATGTCACTCGTCTCCCGGCAACCATCGCCAGGATACCGCCTGTTGCAGTGAGGCTGCAGATGTCTGAA[A/T]GAAACATTCTCAGCCGTTTGGCCAGCAGAGGACCAGACACACAGAGTCAGCAGGTACGTCACACACCTGTGTGAAGAATCTCCTGTGTTTAAACAGGGTACGGTAATATTTAGAAAATCCTATTCTAACCATGTAGTGCATTAATTCTGATGTATCTTAAGCATATAGTTGAAGTCAGAATTATTCGCCCCCCTGATTATTTTTTTCCCCAATTTCTGTTTAACGGAGAGATTTTTTTTCAACACATTTCTAAATATAATAGTTTTAATAACTCATTTCTAATAACTGATTTTTTTTATCTTTGCCATGATGGCAGTAATTAATAATTGACTAGATATTTTTCTAGACACTTCTATACAGCTTAAAGTGACATTTAAAGGCTTAATTAGGCTAACTAGGCAGGTTAGGGTAATTAGGCAAGTTATTGTATAACAATGGTTTGTTCTGTAGACTATCATAAAAAAAGTATATATATATTTATTACTATATATATAGCTTAA
Associated Phenotype:
Not determined