Busch Lab

ZMP

ano2

Ensembl ID:
ENSDARG00000063524
ZFIN ID:
ZDB-GENE-060503-62
Description:
anoctamin 2 [Source:RefSeq peptide;Acc:NP_001103862]
Human Orthologue:
ANO2
Human Description:
anoctamin 2 [Source:HGNC Symbol;Acc:1183]
Mouse Orthologue:
Ano2
Mouse Description:
anoctamin 2 Gene [Source:MGI Symbol;Acc:MGI:2387214]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa40208 Nonsense Mutation detected in F1 DNA Not yet available
sa31370 Essential Splice Site Available for shipment Available now
sa33366 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40209 Nonsense Mutation detected in F1 DNA Not yet available
sa20190 Essential Splice Site Available for shipment Available now
sa31371 Essential Splice Site Available for shipment Available now
sa33367 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40208
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092932 Nonsense 63 984 1 24
ENSDART00000109788 Nonsense 77 998 2 25
Genomic Location (Zv9):
Chromosome 4 (position 4145929)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4264542
GRCz11 4 4273455
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATCTCCAATGGAAGTTATCATTTAGGAGTGGAGGAAAAAGACCCAGAA[G/T]GAGGGAAAGAGGAGCCTGCGGAGGTGGTGGTTGATGTTGGACCACCGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31370
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092932 Essential Splice Site 142 984 3 24
ENSDART00000109788 Essential Splice Site 156 998 4 25
Genomic Location (Zv9):
Chromosome 4 (position 4163112)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4281725
GRCz11 4 4290638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGTTGTTTCCATGCTTCACTGATAATAATAAACACTGTGTCTTGTTCA[G/A]AGTTACGAGCTGAGGGAAGAAAAAGGTCTGGCCGCCACTATGAATGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33366
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092932 Essential Splice Site 229 984 5 24
ENSDART00000109788 Essential Splice Site 243 998 6 25
Genomic Location (Zv9):
Chromosome 4 (position 4163792)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4282405
GRCz11 4 4291318
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATGAAATCCTCAGACGCACAGCCTGCACACGGACCTGCCAAACCATGG[G/A]TTAGTAATGTGTAAATCCATAACCTAAGCATGGACTAGCGTTCAGGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40209
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092932 Nonsense 258 984 7 24
ENSDART00000109788 Nonsense 272 998 8 25
Genomic Location (Zv9):
Chromosome 4 (position 4166648)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4285261
GRCz11 4 4294174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGAGTTTTTCTATGATTTCAGGGTGACTTCCACTCCTCTGGACAAGCC[G/T]AGGGAAAAAACGAAAGACAAGTATGTTGCTACCACAATGCAAATAATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20190
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092932 Essential Splice Site 561 984 16 24
ENSDART00000109788 Essential Splice Site 575 998 17 25
Genomic Location (Zv9):
Chromosome 4 (position 4201649)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4320025
GRCz11 4 4328938
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAGAACTCATCTCTCTGAACCCTACATAATATCACTTCATGTGTCTGC[A/T]GAGATCCCGAAAACTGAGACCAACTTTGAAGAGCGTCTGATTCTGAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31371
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092932 Essential Splice Site 825 984 23 24
ENSDART00000109788 Essential Splice Site 839 998 24 25
Genomic Location (Zv9):
Chromosome 4 (position 4225586)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4343962
GRCz10 KN150482.1 7272
GRCz11 4 4352875
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGCAAGAACTGAATGAGCCCTTAATGACTTTTTCATTTTGTATATTTT[A/T]GGTACAAGGACTACAGAGAGCCTCCATGGTCGAATGAGCCTTACCAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33367
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092932 Nonsense 872 984 24 24
ENSDART00000109788 Nonsense 886 998 25 25
Genomic Location (Zv9):
Chromosome 4 (position 4228161)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4346537
GRCz11 4 4355450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCACTTCCTCCAGAACCTGGTGATAATCATGAGCATGCTGGTGGCCTG[G/A]CTGATCCCGGACATGCCCAAAAACATCAGTGAGCAGTTAAAGAAGGACAA
Associated Phenotype:
Not determined